We narrowed to 16,185 results for: GRN
-
Plasmid#216538PurposegRNA and template for MET 5'UTR uORF2 mutationDepositorInsertpegRNA MET 5'UTR uORF2 mutation
ExpressionMammalianAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
RhoA gRNA #1
Plasmid#198718PurposeCas9-mediated knockout of RhoA in mammalian cells #1DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
RhoA gRNA #3
Plasmid#198720PurposeCas9-mediated knockout of RhoA in mammalian cells #3DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
RhoB gRNA #1
Plasmid#198721PurposeCas9-mediated knockout of RhoB in mammalian cells #1DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
RhoB gRNA #2
Plasmid#198722PurposeCas9-mediated knockout of RhoB in mammalian cells #2DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
RhoB gRNA #3
Plasmid#198723PurposeCas9-mediated knockout of RhoB in mammalian cells #3DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
RhoC gRNA #1
Plasmid#198724PurposeCas9-mediated knockout of RhoC in mammalian cells #1DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
RhoC gRNA #2
Plasmid#198725PurposeCas9-mediated knockout of RhoC in mammalian cells #2DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
RhoC gRNA #3
Plasmid#198726PurposeCas9-mediated knockout of RhoC in mammalian cells #3DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV hGRN2
Plasmid#213683PurposeExpresses human granulin-2 with an N-terminal twin-Strep-FLAG tagDepositorInserthuman Granulin-2
UseAAVTagstwin-Strep-FLAGPromotercytomegalovirus enhancer/chicken β-actin promoterAvailable SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV hGRN4
Plasmid#213684PurposeExpresses human granulin-4 with an N-terminal twin-Strep-FLAG tagDepositorInsertHuman granulin-4 (hGRN4) (GRN Human)
UseAAVTagsTwin-Strep tag and FLAG tag (after signal peptide…Promotercytomegalovirus enhancer/chicken β-actin promoterAvailable SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
p103DestTol2pA2-4xU6sgRNA
Plasmid#227778PurposeDestination vector with U6 driven 4 sgRNAsDepositorInsert4xU6:sgRNA
UseCRISPRPromoterU6Available SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1_Cas9-hGem_Smc4
Plasmid#217667Purposeexpresses Cas9-hGem and guideRNA for tagging of SMC4DepositorInsertsgRNA1 targeting SMC4 C-terminal (SMC4 Human)
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 NT sgRNA5
Plasmid#164930PurposeExpresses Non-targeting sgRNA5 control in mammalian cellsDepositorInsertNon-targeting sgRNA5 (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pgRNA-bacteria_speG_M15
Plasmid#220488Purposeinducible CRISPRiDepositorInsertgspeG
UseCRISPR and RNAiMutationnoneAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pgRNA-bacteria_speG_E23
Plasmid#220489Purposeinducible CRISPRiDepositorInsertgspeG
UseCRISPR and RNAiMutationnoneAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG13 sgRNA
Plasmid#207558PurposepX330 expressing Cas9 and a sgRNA targeting the ATG13 locusDepositorInsertggaaactgatctcaattccc
ExpressionMammalianPromoterCMV and U6Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only