We narrowed to 7,293 results for: GFP expression plasmids
-
Plasmid#182230PurposeLentiviral transfer plasmid for the LeAPS packaging system; encodes GFP-P2A-blasticidin transgeneDepositorInsertGFP-P2A-Blasticidin
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-GFP-LmnB1
Plasmid#164249Purposeretroviral plasmid for GFP-LmnB1DepositorAvailable SinceMay 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Sst44-GFP
Plasmid#172310PurposeSST interneuron-restricted gene regulatory element GRE44, to drive GFP expression in SST+ interneuronsDepositorInsertSst44
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ACE2-GFP
Plasmid#154962PurposepcDNA3.1-ACE2-GFPDepositorAvailable SinceJuly 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV GG hUbV-EGFP
Plasmid#216161PurposeContains a Golden-Gate cloning cassette to express up to four gRNA and EGFPDepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAT9651-BEAR-GFP
Plasmid#162989PurposeBEAR target plasmid with split EGFP and disrupted 5' splice siteDepositorInsertEGFP split with an intron between amino acids 95-96
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRK5-vox-EGFP
Plasmid#79970Purposemammalian GFP reporter plasmid, target site for Vika recombinaseDepositorInsert2 vox-sites flanking neo in frame with EGFP
ExpressionMammalianPromoterCMVAvailable SinceAug. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP[N150TAA]
Plasmid#164581Purposesuperfolder GFP with N150TAA mutationDepositorInsertsfGFP-150TAA
Tags6xHisExpressionBacterialMutationN150TAA MutationPromoterT7Available SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Sst12-GFP
Plasmid#172311PurposeSST interneuron-restricted gene regulatory element GRE12, to drive GFP expression in SST+ interneuronsDepositorInsertSst12
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJL1-sfGFP-DQNAT
Plasmid#198210PurposepJL1 plasmid encoding superfolder GFP modified at the C-terminus with 30 amino acids containing an optimal DQNAT sequon followed by a 6x-His tagDepositorInsertsfGFP_DQNAT
Tags6x His Tag and DQNAT glycosylation tagExpressionBacterialPromoterT7Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Sst22-GFP
Plasmid#172312PurposeSST interneuron-restricted gene regulatory element GRE22, to drive GFP expression in SST+ interneuronsDepositorInsertSst22
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHRdSV40_scFv_GCN4_sfGFP-VPR-GB1_NLS
Plasmid#79373PurposeRecruits VPR to a compatible Cas9 protein for transcriptional activationDepositorInsertGCN4-sfGFP-VPR
UseCRISPRExpressionMammalianAvailable SinceOct. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFAP-Archon-EGFP
Plasmid#187979PurposeExpresses the fluorescent voltage indicator Archon under the GFAP promoterDepositorInsertArchon1-EGFP
UseAAVAvailable SinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP726_L2_pV01_0I_TMV-tGFP_TCTP-fLUC
Plasmid#192406PurposeTo be a control plasmid that has no Rluc repression (replaced by turboGFP) and should reflect true off state of the circuit.DepositorInsertAct2::Turbo GFP
UseSynthetic BiologyTagsN7ExpressionPlantAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT2BR-7xGFP11-HA
Plasmid#221840PurposePlasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(A)
Plasmid#236039PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-D134*
Plasmid#191110PurposeAn E. coli sfGFP reporter with one TAG at position 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*
Plasmid#191111PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUt-MONARCH 1.0_crEGFP
Plasmid#224790PurposeLPUtopia matching RMCE donor plasmid with MONARCH 1.0 circuit with crRNA targeting EGFP. Use BlastR for positive and HSV-TK for negative selectionDepositorInsertcrEGFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMV-d2iAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DO_DIO-TdTomato_EGFP-WPRE-pA
Plasmid#37120PurposeDO/DIO Cre-Switch. Expresses tdTomato in Cre negative cells, expresses EGFP in Cre positive cellsDepositorInsertTdTomato-EGFP
UseAAV and Cre/Lox; Cre-switchPromoterEF1aAvailable SinceJuly 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMVSP6-nEGFP-SV40-PURO
Plasmid#138364PurposeLentiviral plasmid for nuclear EGFP expression driven by CMVSP6 and puromycin resistance under SV40 promoter for selectionDepositorInsertnuclear EGFP
UseLentiviralExpressionMammalianAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-FLPo-T2A-GFP
Plasmid#161766Purposeexpress FLPo and GFP under the control of human synapsin promoterDepositorInsertsFLPo
T2AEGFP
UseAAVExpressionMammalianPromoterhSynapsin1Available SinceNov. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSMART-HCKan-yibDp-VHH-GFPenhancer
Plasmid#202468PurposeExpresses the nanobody GFP enhancer after phosphate depletionDepositorInsertnanobody GFP enhancer
Tags6X-HisExpressionBacterialPromoteryibDpAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSMART-HCKan-yibDp-VHH-GFPminimizer
Plasmid#202469PurposeExpresses the nanobody GFP minimizer after phosphate depletionDepositorInsertnanobody GFP minimizer
Tags6X-HisExpressionBacterialPromoteryibDpAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pB6-Hipp11-H2B-sfGFP-T2A-tdTomato-cre reporter-3pA stop-FNF-DTA
Plasmid#183027PurposeB6J Hipp11-FNF-pCAG-loxP-3xSV40pA-loxP-H2B-sfGFP-T2A-tdTomato-WPRE-bpA allele targeting vector, low copy numberDepositorInsertH2B-sfGFP-T2A-tdTomato
UseCre/Lox and Mouse TargetingExpressionBacterial and MammalianAvailable SinceApril 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pALS2-sfGFP WT
Plasmid#197575PurposeFluorescence control plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses sfGFP-WT and M. alvus Pyl-tRNA(6). p15a origin of replicationDepositorInsertssfGFP WT
M. alvus Pyl-tRNA (6)
TagsHis6ExpressionBacterialPromoteraraC and lppAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
2xMARS-nGFP
Plasmid#205235PurposeExpresses two repeats of PLEKHA5 aa 143-271 (K163A and R164A) fused to a HA-tagged GFP nanobody in mammalian cellsDepositorInsert2xPLEKHA5(143-271)-K163A/R164A-HA-nGFP (PLEKHA5 Human)
TagsHA, Nuclear Export Sequence, mScarlet-i, and nGFP…ExpressionMammalianMutationamino acids 143-271 of PLEKHA5 (GenBank reference…PromoterCMVAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
MARS-nGFP
Plasmid#205234PurposeExpresses PLEKHA5 aa 143-271 (K163A and R164A) fused to a HA-tagged GFP nanobody in mammalian cellsDepositorInsertPLEKHA5 aa 143-271 (K163A and R164A) fused to a HA-tagged GFP nanobody (PLEKHA5 Human)
TagsHA, Nuclear Export Sequence, mScarlet-i, and nGFP…ExpressionMammalianMutationamino acids 143-271 of PLEKHA5 (GenBank reference…PromoterCMVAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
ST-Tstem(5A)-GFP
Plasmid#162502PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. The mutated stem region of Tac is inserted within ST.DepositorTagsGFPExpressionMammalianMutationThe mutated Tac stem region is inserted within ST…Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
ST-Tstem-GFP
Plasmid#162501PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. The stem region of Tac is inserted within ST.DepositorTagsGFPExpressionMammalianMutationThe Tac stem region is inserted within ST6Gal1Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
eGFP-PRM-3R
Plasmid#112156PurposeMammalian eGFP expression plasmid for PRM-3R.DepositorInsertPRM-3R (ABL1 Human)
ExpressionMammalianMutationcontains only the PRM domain of ABl1PromoterCMVAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GFP1 POD-nAb-WPRE
Plasmid#244973PurposeExpresses a fusion protein of a nanobody against GFP and peroxidase (POD) in mammalian cellsDepositorInsertGFP1 POD-nAb
Available SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-DTR-GFP
Plasmid#124364Purposeconditional expression of a diphtheria toxin receptor (DTR)–GFP fusion proteinDepositorHas ServiceAAV2InsertDTR-GFP
UseAAVTagsGFPPromoterChicken B-actinAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EFS-PCP-GFPnls
Plasmid#121938PurposeCRISPR-Sirius plasmidDepositorInsertPCP-GFPnls
UseLentiviralTagssfGFPExpressionMammalianPromoterEFSAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pACAGW-H2B-PAGFP-AAV
Plasmid#33000DepositorInsertH2B-PAGFP (H2BC21 Aequorea victoria, Human)
UseAAV; Adeno associated virusTagsPAGFPExpressionMammalianAvailable SinceDec. 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
scFv-GCN4-sfGFP-deadTET1CD
Plasmid#184442PurposeCatalytically DEAD TET1CD with scFv against GCN4DepositorInsertCatalytically DEAD TET1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLoxP-EGFP-crRNA-entry
Plasmid#213048PurposeSWITCHER ready LoxP-EGFP reporter plasmid for cloning of a customized CRISPR-inducible Cre-constructDepositorInsertLoxP-EGFP-MALAT1-triplex
UseCRISPRExpressionMammalianAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-22b(+) pCopA sfgfp
Plasmid#226374PurposePlasmid carries copper sensor circuit genes for whole-cell sensing of copper ions with native RBS (ribosome binding site).DepositorInsertsfGFP
Tags6x HisTagExpressionBacterialPromoterpCopAAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
Zhou-pLOV-GFP-Luc
Plasmid#161030PurposeLentiviral vector expressing GFP and luciferase for use as a reporter in pseudovirus production and infection.DepositorInsertGFP and luciferase
UseLentiviralAvailable SinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-EGFP12-WT(TTTT)
Plasmid#215856PurposeThis plasmid encodes sgRNA that target EGFP with stretch sequenceDepositorInsertsgRNA-EGFP12 with TTTT stretch
UseRetroviralExpressionMammalianAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-EGFP-NLS-3XFLAG-V5
Plasmid#196090PurposeExpresses gfp in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertGFP
TagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianPromoterCAGGsAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
p226-AAV-dlx-dio-mScarlet-T2A-SYPEGFP
Plasmid#185696PurposeAAV vector expressing cre-dependent mem-mScarlet, T2A, Synaptophysin-EGFP driven by Dlx promoterDepositorInsertmScarlet, T2A, Synaptophysin-EGFP
UseAAV and Cre/LoxTagsmScarlet palmitoylation, Synaptophysin fused to E…ExpressionMammalianPromotermDlxAvailable SinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
LITE1.0_pAAV_hSyn_TALE(Grm2)-NLS-CIB1_2A_GFP_WPRE_bGHpA
Plasmid#47453PurposeepiLITE / LITE1.0 TALE-CIB1. CIB1 binds to blue-light-activated CRY2PHR. Particular TALE targeted to Grm2 promoter. Synapsin promoter for neuronal expression.DepositorInsertTALE (N136,Grm2,C63)-cib1
UseAAV; TaleTagsHAExpressionMammalianPromoterhSyn human synapsin (mammalian neuronal expressio…Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV2.5-THP-GFP/WGA
Plasmid#80337PurposeFluorescent Reporter for Dopaminergic Neuron DifferentiationDepositorAvailable SinceOct. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-hMLH1dn-eGFP
Plasmid#191104PurposeLentiviral expression plasmid of hMLH1dn with P2A-eGFP reporterDepositorInserthMLH1dn
UseLentiviralExpressionMammalianPromoterEF-1aAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-TET-GFP-FF3
Plasmid#11662Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a tetracycline-responsive promoter (TET) controlling expression of GFP and miR30-based shRNA targeting firefly luciferaseDepositorInsertFF3
UseLentiviralTagsGFPExpressionMammalianAvailable SinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only