We narrowed to 16,429 results for: grna
-
Plasmid#168294PurposeExpresses gRNA targeting the yellow gene in DrosophilaDepositorInsertU6.3-gRNA[y]-scaffold
ExpressionInsectAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_AAVS1_sgRNA_2
Plasmid#155105Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting the AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIAL1
Plasmid#106096PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIAL1DepositorInsertgRNA TIAL1
UseCRISPRAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBP_sgRNA
Plasmid#190128PurposeLevel 0 MoClo plasmid for Golden Gate cloning of sgRNAsDepositorTypeEmpty backboneUseCRISPRAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
gRNA_DNMT3a-T1
Plasmid#41821PurposeExpresses a guide RNA (gRNA) to target DNMT3a (T1 target sequence) for genome engineeringDepositorAvailable SinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMC0x_gRNA_Pos5_Ptet
Plasmid#179336PurposegRNA Position Vector 5, used to create multi gRNA NT-CRISPR plasmid with pST_119_LVL2 camDepositorInsertPtet gRNA with sfGFP dropout
UseCRISPRAvailable SinceMarch 21, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSpCas9_U6_sgRNA_Mettl3C
Plasmid#165420PurposesgRNA construct for targeting Mettl3 C-terminusDepositorAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_LMD9
Plasmid#110626PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterCAG and hU6Available SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHpgRNA13
Plasmid#160127PurposeTo express a sgRNA with constant targeting ADE2 by RNA pol II promoter PTEF1DepositorInsertPTEF1-HH-gRNA-ADE2- HDV-TAMO
ExpressionYeastAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_ZNF598
Plasmid#127121DepositorInsertgRNA ZNF598 (ZNF598 Human)
UseCRISPRAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1_ASCL1
Plasmid#64129PurposePhotoactivatable transcription system. Lentiviral expression of ASCL1 sgRNA1. Also contains a CMV-puro-t2A-mCherry expression cassette.DepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_LacZ_sgRNA
Plasmid#74179Purposelentiviral vector expressing sgRNA targeting LacZDepositorInsertLacZ sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
gRNA_DNMT3a-T2
Plasmid#41822PurposeExpresses a guide RNA (gRNA) to target DNMT3a (T2 target sequence) for genome engineeringDepositorAvailable SinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
p184_LTJ_sgRNACD90.2
Plasmid#82670PurposesgRNA targeting murine CD90.2. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting mouse CD90.2
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_AAVS1_sgRNA_2
Plasmid#155085Purposelentiviral plasmid expressing Cas9 gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TRIM25_G1
Plasmid#127119DepositorInsertgRNA TRIM25 (TRIM25 Human)
UseCRISPRAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSPneogRNAH
Plasmid#63556PurposeExpresses gRNA in LeishmaniaDepositorInsertguide sequence
UseLeishmania expressionAvailable SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
gRNA_DNMT3b
Plasmid#41823PurposeExpresses a guide RNA (gRNA) to target DNMT3b for genome engineeringDepositorAvailable SinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
1x_a1gRNAOp_pCYC1m_yeBFP2
Plasmid#64390Purposeencodes one a1 operator site upstream of minimal pCYC1 promoter driving yeast enhanced BFPDepositorInsertyeast enhanced BFP2
ExpressionYeastAvailable SinceMay 5, 2015AvailabilityAcademic Institutions and Nonprofits only