We narrowed to 3,157 results for: bad
-
Plasmid#169119PurposeTESEC expression vector for TrpD from M. tuberculosisDepositorInserttrpD (trpD Mycobacterium tuberculosis H37Rv)
UseSynthetic BiologyExpressionBacterialMutationCodon optimized for E. coliPromoterpBADAvailable SinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET11a-Z-N-DiB-RM
Plasmid#168475PurposeN-fragment of the DiB-RM‐split‐Zip protein. This plasmid needs to be co-transformed with Plasmid 168477: pMRBad-Z-C-DiB-RM to obtain DiB-RM‐split-Zip proteinDepositorInsertN-fragment of DiB-RM + Leucine Zipper
TagsHis-tagExpressionBacterialPromoterT7Available SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVH009
Plasmid#80399PurposeControl plasmid with no anti-scaffold feedback. Contains pBAD-CusR (response regulator) and pCusR-YFP-AAV.DepositorUseSynthetic BiologyTagsC-terminal LZx domain and N-terminal 3xFLAG tag, …ExpressionBacterialAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
Gg 1.8kb rhodopsin GFP
Plasmid#72917PurposeRhodopsin promoter from chicken (Gallus gallus) gDNA chr12:19,499,638–19,501,514 in galGal4 driving GFPDepositorInsertchicken rhodopsin (RHO Chicken)
Available SinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
Gg 1.8kb rhodopsin DsRed
Plasmid#72916PurposeRhodopsin promoter from chicken (Gallus gallus) gDNA chr12:19,499,638–19,501,514 in galGal4 driving DsRedDepositorInsertchicken rhodopsin (RHO Chicken)
PromoterrhodopsinAvailable SinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAN-OR-MalT-3NT
Plasmid#62309Purposesynthetic circuit: OR gate, the sgRNA used for the NOT gate was substituted with one designed to target the malT gene in the E. coli genomeDepositorInsertsA2NT sgRNA
Malt-3NT sgRNA
A2NT sgRNA
UseCRISPRExpressionBacterialPromoterPA2, PPhlF, and pBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMS_375
Plasmid#182132Purposeexpresses retron RNA, ec.86 Reverse Transcriptase, CspRecT SSAP, and mutL* to create a specific rifampicin resistance mutation while inhibiting MMRDepositorInsertsretron RNA
ec.86 RT
CspRecT
Mutationincorporated rifampicin-resistance-conferring don…Available SinceSept. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLyGo-Ec-7
Plasmid#163135PurposepLyGo cloning vector for surface display in E. coli of a sequence of interest (LPMO). Vector encoding the C-IgAP surface expression anchor, nanobody, and the LyGo cassette (SapI-ccdB-SapI)DepositorTypeEmpty backboneUseSynthetic BiologyTagsNanobody, C-IgAP autotransporterExpressionBacterialPromoterP(rhaB)Available SinceMay 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEVOL_PylRS(WT)-tRNA
Plasmid#223512PurposePylRS (WT)/tRNA Pyl orthogonal pair for genetic code expansion that allows site-specific incorporation of noncanonical amino-acids into a POI using the Amber stop codonDepositorInsertsTags6xHisExpressionBacterialPromoteraraBAD, rrnB, and glnS and proKAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREDCas9
Plasmid#71541PurposeConstitutive expression of Cas9, inducible expression of the Red recombineering system, and inducible expression of the plasmid curing system for CRISPR mediated genome editing of E. coli.DepositorInsertsCas9
lambda red genes
plasmid curing system
ExpressionBacterialPromoterpBADAvailable SinceJuly 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEvol-MjaYRS
Plasmid#153557PurposeAmber suppression for incorporating 3-aminotyrosine to proteins in E. coliDepositorInsertsMJaYRS (first copy)
MJaYRS (second copy)
amber suppression tRNA under proK promoter
ExpressionBacterialPromoterglnS and pBADAvailable SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEVOL_PylRS(AF)-tRNA
Plasmid#223511PurposePylRS (AF)/tRNA Pyl orthogonal pair for genetic code expansion that allows site-specific incorporation of noncanonical amino-acids into a POI using the Amber stop codonDepositorInsertsTags6xHisExpressionBacterialMutationY306A; Y384FPromoteraraBAD, rrnB, and glnS and proKAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSAM_AraC
Plasmid#91569PurposeMariner transposon mutagenesis & sequencing vector - Transposon contains KanR and Illumina sequencing adapters. Arabinose promoter expresses transposase. Ampicillin resistance on backbone.DepositorInsertAraC/PBAD
ExpressionBacterialAvailable SinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCas3-Km
Plasmid#207999PurposeExpresses all necessary components of Type I-C CRISPR-Cas systemDepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas3-Sm
Plasmid#208001PurposeExpresses all necessary components of Type I-C CRISPR-Cas systemDepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-NBK-1
Plasmid#207639PurposeA plasmid for the expression of M. mazei pyrrolysine aminoacyl-tRNA synthetase/tRNA pair (PylRS/tRNAPyl) in E. Coli.DepositorInsertPyl-tRNACUA and 2x pyrrolysyl-tRNA synthetase (MmPylRS)
ExpressionBacterialMutationThe evolved synthetase NBK-1 contains mutations Y…PromoteraraBADAvailable SinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-AckRS
Plasmid#137976Purposesequence optimized N‐acetyl lysyl‐tRNA synthetase with cognate tRNA for genetic code expansionDepositorInsertAckRS and pylTcua
ExpressionBacterialPromoteraraBADAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCas3-Amp
Plasmid#207998PurposeExpresses all necessary components of Type I-C CRISPR-Cas systemDepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJBEI-6411
Plasmid#47050PurposeBglBrick plasmid (=pBbB8k-P450) coding for a cytochrome P450 and its associated reductases to oxidize limonene to perillyl alcohol in E. coliDepositorInsertahpG-ahpH-ahpI coding for cytochrome P450 (CYP153A6) and its associated ferredoxin and ferredoxin reductase
UseSynthetic Biology; BglbrickExpressionBacterialPromoterPbadAvailable SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
N-BLa 1.2
Plasmid#88999PurposeBLaTM, a genetic tool to measure homo- and heterotypic transmembrane helix-helix interactions. Plasmid encoding the 1.2 fusionprotein containing the N-terminal fragment of the split β-lactamase.DepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialPromoteraraBADAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-AcKRS-CloDF
Plasmid#127415PurposeMutant of mmPylRS designed for incorporation of non-canonical amino acids (acyl-lysine derivatives) in to M13 bacteriophageDepositorInsertPyrrolysyl-tRNA synthetase/pyrrolysyl -tRNA pair
ExpressionBacterialPromoteraraBADAvailable SinceApril 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXPR-SF61
Plasmid#163916PurposetRNA synthetase/tRNA pair for the in vivo incorporation of para-Pentafluorosulfanyl-Phenylalanine, into proteins in E. coli in response to the amber (TAG) codonDepositorInsertSF5Phe tRNA synthetase
ExpressionBacterialPromoteraraBADAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEDF-PhdRS
Plasmid#127445PurposeDouble mutant of wild type mmPylRS designed for incorporation of non-cannonical amino acids in to M13 bacteriophageDepositorInsertPyrrolysyl-tRNA synthetase/pyrrolysyl -tRNA pair
ExpressionBacterialMutationN346A-C348A mutations on PylRSPromoteraraBADAvailable SinceApril 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAGE2.0-i
Plasmid#194639PurposeEmpty pAGE2.0 plasmid with pBAD inducible promoterDepositorTypeEmpty backboneUseSynthetic Biology; Diatom expressionExpressionBacterial and YeastAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
N-BLa 1.1
Plasmid#88994PurposeBLaTM, a genetic tool to measure homo- and heterotypic transmembrane helix-helix interactions. Plasmid encoding the 1.1 fusionprotein containing the N-terminal fragment of the split β-lactamase.DepositorInsertN-BLa 1.1 fusion protein
TagsFlagExpressionBacterialPromoteraraBADAvailable SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 RL3Sc
Plasmid#109365PurposeHuman rod opsin chimera with intracellular loop 3 from Scallop opsin with 1D4 tagDepositorInsertTags1D4ExpressionMammalianPromoterCMVAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBXNPHM3-Nb_MsbA#1
Plasmid#186428PurposePlasmid for bacterial expression of MsbA binding Nanobody Nb_MsbA#1DepositorInsertNanobody Nb_MsbA#1
UseAffinity Reagent/ AntibodyTags3C cleavage site, His Tag, Maltose Binding Protei…PromoterpBADAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCas9GG
Plasmid#131009PurposeBackbone plasmid for generating CRISPR arrays for SpCas9 using CRATES. Contains a direct repeat and a RFP-dropout cassette.DepositorInsertsdirect repeat of SpCas9
promoter PJ23119
mRFP expression cassette
UseCRISPRExpressionBacterialPromoterBba_R0040 TetRAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 RL3Am
Plasmid#109364PurposeHuman rod opsin chimera with intracellular loop 3 from Amphioxus opsin 1 with 1D4 tagDepositorInsertRod opsin chimera with Amphioxus Opsin1 intracellular Loop 3 (RHO Branchiostoma belcheri, Human)
Tags1D4ExpressionMammalianPromoterCMVAvailable SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only