We narrowed to 7,002 results for: tet
-
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pTRE/SP M87 N184X
Plasmid#92373PurposeInducible expression of M87 N184X spastin in mammalian cellsDepositorInsertspastin (SPAST Human)
ExpressionMammalianMutation1-460 bp deleted, N184XPromoterTet-responsive P tightAvailable SinceJune 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRE/SP M87 S245X
Plasmid#92374PurposeInducible expression of M87 S245X spastin in mammalian cellsDepositorInsertspastin (SPAST Human)
ExpressionMammalianMutation1-460 bp deleted, S245XPromoterTet-responsive P tightAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestGFP_RBPMS2
Plasmid#65747Purposeexpresses GFP-tagged RBPMS2 in mammalian cellsDepositorInsertRBPMS2 (RBPMS2 Human)
TagsGFPExpressionMammalianMutationS13N mutation in RBPMS2PromoterCMV, 2x TetAvailable SinceAug. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pASKt15C+SrtA5woH
Plasmid#65019PurposeExpresses the P94R/D160N/D165K/K190E/K196T mutant of Staphylococcus aureusDepositorInsertsortase A
TagsS tagExpressionBacterialMutationdeleted amino acids 1-59, P94R, D160N, D165A, K19…Promotertetracycline promoter/operatorAvailable SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTwist GFP-Linker-VDAC1
Plasmid#211735PurposeExpresses GFP tagged VDAC1 in mammalian cells. GFP is attached to the N-terminus of VDAC1 with a flexible linker.DepositorAvailable SinceFeb. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCas9CR4-NG
Plasmid#120225PurposepCas9CR4 with mutations to change PAM site specificity to NG from Nishimasu et al.DepositorInsertSpCas9-NG
UseSynthetic BiologyTagsssrAMutationMutations R1335V/L1111R/D1135V/G1218R/E1219F/A132…PromoterpTetAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ-FFSS-Cyclin D1 (HP)
Plasmid#215150PurposeExpresses FFSS-Cyclin D1 (HP) in mammalian cells from an inducible lentiviral vector.DepositorInsertCCND1 (CCND1 Human)
UseLentiviralTagsFFSS (FLAG-FLAG-STREP-STREP)ExpressionMammalianMutationCyclin D1(HP) denotes mutations M56A, V60A, and W…PromoterCMV (Tet inducible)Available SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_R38E
Plasmid#65665PurposeFLAG-HA expression vector with RBPMS carrying mutation R38EDepositorInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationchanged arginine 38 to glutamic acidPromoterCMV, 2x TetAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_KDR_F65A
Plasmid#65092PurposeDestination vector with RBPMS resistant to siRNA treatment by s21729 (Applied Biosystems) with F65A mutation for stable cell line generationDepositorInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationchange phenylalanine 65 to alanine (KDR backbone)PromoterCMV, 2x TetAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_KDR_F27A
Plasmid#65661PurposeFLAG-HA expression vector with RBPMS carrying mutation F27A and encoding silent mutation to render resistant to siRNA R2 (Farazi et al. 2014)DepositorInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationchanged phenylalanine 27 to alanine (KDR backgrou…PromoterCMV, 2x TetAvailable SinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
circRAJ31
Plasmid#69926PurposeExpresses RAJ31 riboregulator encased in a permuted intron exon ribozyme, which circularises the riboregulator.DepositorInsertplTet-circRAJ31
UseSynthetic BiologyExpressionBacterialPromoterPltetO1-2Available SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKB223
Plasmid#170013PurposeEncodes LacI-controlled expression of surface-displayed C18G and PvirK-mNeonGreen reporterDepositorArticleInsertsmNeonGreen
C18G
UseSynthetic BiologyTagsLpp, OmpA, and TetherExpressionBacterialPromoterPtac and PvirKAvailable SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLQ-KO-tgt50
Plasmid#126578PurposeCRISPR-Cas9 based efficient genome editing in S. aureusDepositorInsertCas9-Pxyltet-sgRNA-Pspac-donor-tgt50
UseCRISPRExpressionBacterialAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
SMT215
Plasmid#134818PurposeSMT205 with DHFR-FLAG-tag, western blotDepositorInsertsDihydrofolate reductase
Thymidylate synthase
TagsFLAGExpressionBacterialMutationSilent mutations to eliminate internal restrictio…PromoterT7 and TETAvailable SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestMYC_RBPMS2
Plasmid#65668PurposeMYC expression vector with RBPMS2DepositorInsertRBPMS2 (RBPMS2 Human)
TagsMYCExpressionMammalianMutationintroduced HindIII site to exchange FLAG-HA tag w…PromoterCMV, 2x TetAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_KDR_K100E
Plasmid#65093PurposeDestination vector with RBPMS resistant to siRNA treatment by s21729 (Applied Biosystems) with K100E mutation for stable cell line generationDepositorInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationchanged lysine 100 to glutamic acid (KDR backgrou…PromoterCMV, 2x TetAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_KDR_K100A
Plasmid#65663PurposeFLAG-HA expression vector with RBPMS carrying mutation K100A and encoding silent mutation to render resistant to siRNA R2 (Farazi et al. 2014)DepositorInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationchanged lysine 100 to alanine (KDR background)PromoterCMV, 2x TetAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_R38A_E39A
Plasmid#65664PurposeFLAG-HA expression vector with RBPMS carrying mutation R38A, E39ADepositorInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationchanged arginine 38 to alanine, and glutamic acid…PromoterCMV, 2x TetAvailable SinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNM3755
Plasmid#154116PurposetetO 7X ∆pes-10 promoter driving GFP-C1 & an act-4 3' UTR in a RMCE vectorDepositorInserttetO 7X::∆pes-10::GFP-C1::act-4 3'
UseRmceExpressionWormPromoternot applicableAvailable SinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNM3724
Plasmid#154112PurposetetO 7X ∆pes-10 promoter driving GFP-C1 in an RCME vectorDepositorInserttetO 7X::∆pes-10::GFP-C1::tbb-2 3'
UseRmceExpressionWormPromoternot applicableAvailable SinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFastBacMam8_N_Flag_3C
Plasmid#178818PurposeBaculovirus gene transfer into Mammalian cells to product recombinant proteins.DepositorTypeEmpty backboneTagsFlag, 3CExpressionMammalianPromoterCMVAvailable SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestMYC_RBPMS_KDR
Plasmid#65667PurposeMYC expression vector with RBPMS encoding silent mutation to render resistant to siRNA R2 (Farazi et al. 2014)DepositorInsertRBPMS (RBPMS Human)
TagsMYCExpressionMammalianMutationintroduced HindIII site to exchange FLAG-HA tag w…PromoterCMV, 2x TetAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_R38Q
Plasmid#65094PurposeDestination vector with RBPMS with R38Q mutation for stable cell line generationDepositorInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationchanged arginine 38 to glutaminePromoterCMV, 2x TetAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_K36A_R38A_E39A
Plasmid#65657PurposeFLAG-HA expression vector with RBPMS carrying mutation K36A, R38A, E39ADepositorInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationchanged lysine 36 to alanine, arguing 38 to alani…PromoterCMV, 2x TetAvailable SinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_KDR_E97A_K100A
Plasmid#65660PurposeFLAG-HA expression vector with RBPMS carrying mutation E97A, K100A and encoding silent mutation to render resistant to siRNA R2 (Farazi et al. 2014)DepositorInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationchanged glutamic acid 97 to alanine, lysine 100 t…PromoterCMV, 2x TetAvailable SinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEM405
Plasmid#248738PurposepTetR56 driving sfGFP in pNBU2 integrative Bacteroides plasmidDepositorInsertPBfP2E5-RBS1PLP-TetR-rrnBT1-pTetR56-RBS1PLP-sfGFP-rrnBT2
ExpressionBacterialAvailable SinceJan. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
THOC4
Plasmid#156083PurposeFor use in RBP tethering screenDepositorAvailable SinceSept. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-GCaMP6s
Plasmid#183809PurposeThis plasmid is for use with neuronal cell-type selective activity tagging. The GCaMP6 expression requires both neural activity and Cre recombinase.DepositorInsertAAV transgene TetO promoter-DIO/flex-GCaMP6
UseAAV, Cre/Lox, and Mouse TargetingExpressionMammalianAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-TTP(C147R)-GG-PUF
Plasmid#52138PurposeReceiving vector for PUM-HD assembly and expression in mammalian cellsDepositorTypeEmpty backboneTags(GGGGS)3GGGG linker, 3xFlag, PUM-HD flanking regi…ExpressionMammalianPromoterCMVAvailable SinceMay 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
KNS2
Plasmid#28122PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 22, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTU1-A-fbp_RiboJ_GFP+_MGApt_Bba_B0015
Plasmid#107578PurposeB. megaterium DSM319 fbp promoter, GFP+ with malachite green mRNA aptamer for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)DepositorInsertGFP+
UseSynthetic BiologyTagsB. megaterium DSM319 xylA leader sequence (MTSSKI…ExpressionBacterialMutationF64L/ S65T/ Q80R/ F99S/ M153T/ V163APromoterfbp promoter Bacillus megaterium DSM319Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_KDR
Plasmid#65091PurposeDestination vector with RBPMS resistant to siRNA treatment by s21729 (Applied Biosystems) for stable cell line generationDepositorInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationchanged sequence to render plasmid resistant to s…PromoterCMV, 2x TetAvailable SinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_K36E_R38E
Plasmid#65095PurposeDestination vector with RBPMS with K36E/R38E mutation for stable cell line generationDepositorInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationchange lysine 36 to glutamic acid and arginine 38…PromoterCMV, 2x TetAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_KDR_111del
Plasmid#65659PurposeFLAG-HA expression vector with RBPMS carrying deletion at amino acid 111 (1-111) and encoding silent mutation to render resistant to siRNA R2 (Farazi et al. 2014)DepositorInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationintroduced stop codon such as to produce deletion…PromoterCMV, 2x TetAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_K36E_R38A_E39A
Plasmid#65658PurposeFLAG-HA expression vector with RBPMS carrying mutation K36E, R38A, E39ADepositorInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationchanged lysine 36 to glutamic acid, arginine 38 t…PromoterCMV, 2x TetAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAT-9218
Plasmid#124225PurposeBacterial SpCas9 expressionDepositorInsertSpCas9
UseCRISPRExpressionBacterialPromoterTetR/TetAAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEM-Cas9HF1-indRecA56
Plasmid#102294PurposeModified from pEM-Cas9HF1 (Addgene ID: 89961) to co-express inducible recA56 to block recA-mediated double-strand break repair.DepositorInsertsCas9HF1
recA56
UseCRISPRExpressionBacterialMutationN497A/R661A/Q695A/Q926APromoterpTetAvailable SinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSKB3.MPN348
Plasmid#11437DepositorInsertmethenyltetrahydrofolate synthetase
Tags6x His and TEV cleavage siteExpressionBacterialAvailable SinceApril 10, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAB085c
Plasmid#79208PurposeDirected Evolution of Protein-Protein InteractionsDepositorInsertPlacZ-opt (OR1) luxAB; Ptet 434cI-TnTBR3-FL
ExpressionBacterialPromoterPlacZ-opt (OR1); PtetAvailable SinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
EGFP-uTEV1-MAVS
Plasmid#170998PurposeHiLITR protease with MAVS c-terminal tmd targeting information (Mitochondria)DepositorInsertEGFP-uTEV1-MAVS(tmd)
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterpTRE-tight (TetOn)Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pINTO-NSA::mEzh2
Plasmid#61725PurposeExpression of mouse Ezh2 fused to monomeric streptavidin (N-terminus)DepositorInsertEnhancer of zeste homolog 2 (Ezh2 Mouse)
TagsmSA (monomeric streptavidin)ExpressionMammalianPromoterT-REx (CMV + 2xTetO2)Available SinceJan. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-mRuby2-bGH]-EFS-rtTA-T2A-mGL-P2A-PuroR-WPRE
Plasmid#235268PurposeLentiviral expression of ComMAND base gene regulating mRuby2DepositorInsertmRuby2
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA221MBPc-AID-T7RNAP
Plasmid#167975PurposeExpresses fusion protein MBPc-AID-T7RNAP in E. coliDepositorInsertMBPc-AID-T7RNAP
TagsMBPc and T7RNAPExpressionBacterialPromoterTetR-PtetAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
SL535
Plasmid#49941PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1246
Plasmid#49960PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+) 6xHis-TEV-IFIT3
Plasmid#53559Purposebacterial expression of IFIT3DepositorAvailable SinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTPTP alpha (CCSS)
Plasmid#17692DepositorAvailable SinceApril 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-TS.FF4x1-mRuby2-bGH]-EFS-rtTA-T2A-mGL-P2A-PuroR-WPRE
Plasmid#235316PurposeLentiviral expression of mRuby2 with 5' microRNA target site only (closed-loop)DepositorInsertmRuby2
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-TS.FF6x1-mRuby2-miRE.FF4-bGH]-EFS-rtTA-T2A-mGL-P2A-PuroR-WPRE
Plasmid#235323PurposeLentiviral expression of ComMAND open-loop circuit regulating mRuby2, design 3DepositorInsertmRuby2
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only