We narrowed to 6,894 results for: mCherry
-
Plasmid#217659Purposeexpresses Cas9-hGem and guideRNA targeting the human AAVS1 safe harbour locusDepositorInsertsgRNA2 targeting the human AAVS1 safe harbour locus
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRY2olig-mCh-Nck
Plasmid#60034PurposeExpresses a fusion containing CRY2olig (PHR, E490G) with mCherry and 3 SH3 domains of NckDepositorInsertCRY2-mCh-NCK (CRY2 Mustard Weed, Human)
TagsHA tagExpressionMammalianMutationM354I, E490G CRY2PromoterCMVAvailable SinceNov. 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyn-Akt-STOPS
Plasmid#175009PurposePlasma membrane-targeted Akt-STOPS.DepositorInsertLyn-mCherry-Akt-STOPS
TagsN-terminal targeting sequence from Lyn kinase and…ExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAN2981
Plasmid#127246PurposeAsymmetric degronSwitchA_t8 fused to mCherry with KeyA-BFPDepositorInsertpPGK-Key_A_e18-TagBFP-P2A-mCherry-asym_degronSwitch_A_t8-WPRE
UseLentiviral and Synthetic BiologyAvailable SinceJune 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pASPIre1
Plasmid#154842PurposeDerivative of pSEVA291 carrying the bxb1 gene under the control of a rhamnose-inducible promoter and mCherry flanked by attB/P sitesDepositorInsertBxb1 controlled by rhamnose-inducible promoter; attB/attP-flanked discriminator containing mCherry; rhaRS operon
ExpressionBacterialPromoterPrhaAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
VanGlow-RR
Plasmid#83343Purposefor Gateway cloning of promoter elements upstream of a mCherry::Renilla(nls) reporter, facilitating qualitative and quantitative analysis of expression in transgenic fly lines and S2 cells.DepositorTypeEmpty backboneUseLuciferaseTagsmCherry::Renilla(nls)ExpressionInsectAvailable SinceDec. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-pmEMBer
Plasmid#174441PurposePlasma membrane-targeted ERK monobody binder for local inhibition of ERK activity in live cells.DepositorInsertpmEMBer
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
CSAC-Crys
Plasmid#164967PurposeExpresses sgRNA in mammalian cellsDepositorInserthU6-sgCry1_2-hU6-sgCry2_1-hU6-sgCry2_2
UseAAVTagsmCherryPromoterhU6, hSynAvailable SinceMay 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
attB53_SNCB+_attB53
Plasmid#183614PurposeRMCE vector to shuttle puromycin resistance, anti-GFP SynNotch receptor, tagBFP and TRE-mCherry cassettes into attP50-flanked landing pad (Addgene 183609). All cassettes on sense (+) strand.DepositorInsertsLaG17 GFP nanobody SynNotch tTA
TRE-mCherry-SV40pA
tagBFP
UseRmceTagsMyc and human CD8a signal sequenceExpressionMammalianAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
CSAC-Bmal1
Plasmid#168296PurposeExpresses sgRNA in mammalian cellsDepositorInserthU6-sgBmal1-1-hU6-sgBmal1-3
UseAAVTagsmCherryPromoterU6, hSynAvailable SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
XW17
Plasmid#65835PurposePunc-4-QF-3'UTR-SL2-mCherry-unc-54 (The endogenous SphI, KpnI and SacI sites in QF are removed for the convenience of cloning, most sites are compatible with pPD95.77)DepositorInsertOR74A quinic acid utilization activator (qa-1F)
TagsmCherryExpressionWormMutationThe endogenous SphI, KpnI and SacI sites in QF ar…Available SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKM294
Plasmid#134179PurposeMammalian expression of CENP-C and KNL2DepositorAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEnt R3L2 TetO(sh) mCh-Rs1-2
Plasmid#24417DepositorInsertRs1
UseEntry vectorTagsFLAG and mCherryMutationHuman 5HT4B receptor with D100A mutation, generat…Available SinceMarch 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pHL 1917
Plasmid#53024PurposeAmpR + PCon:RBS (st7)::mCherry::T1 terminator + PLlacO-1::RBS (st7) fimB::Asp terminator + ColE1DepositorInsertsUseSynthetic BiologyTagsAsp terminator, RBS(st7), and T1 terminatorExpressionBacterialPromoterpCon and pLlacO-1Available SinceMay 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-2
Plasmid#121423PurposesgYAP-2 sequence: GAGATGACTTCCTGAACAGTG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-2
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pSR04
Plasmid#69151Purposeread-outloxP mCherry to GFP switch, with eft-1::tagBFP::tbb-2UTR as gene of interest for integration on cxtTi10816, Mos Chr IVDepositorInsertsmCherry
TagBFP
eGFP
UseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promotereef-1A.1 (eft-3) and rps-27Available SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTKI-Tyr
Plasmid#247647PurposeExpresses GFP-SUMO-Tyr-mCherry N-degron reporter driven by aTc responsive promoter, from KanR integrating mycobacterial plasmid lacking Ulp1DepositorInsertGFP-SUMO-Tyr-mCherry N-degron proteolysis dual-fluorescence reporter
UseMycobacterial integratingTagsHA tag and Myc tagExpressionBacterialPromoterPTetAvailable SinceDec. 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTKI-Ser
Plasmid#247648PurposeExpresses GFP-SUMO-Ser-mCherry N-degron reporter driven by aTc responsive promoter, from KanR integrating mycobacterial plasmid lacking Ulp1DepositorInsertGFP-SUMO-Ser-mCherry N-degron proteolysis dual-fluorescence reporter
UseMycobacterial integratingTagsHA tag and Myc tagExpressionBacterialPromoterPTetAvailable SinceDec. 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLN053
Plasmid#247313PurposeExpression of PopZ fused to mCherry and sfGFP under the control of the PopZ promoter (KanR)DepositorInsertPopZ (popZ Caulobacter crescentus)
TagsmCherry and sfgfpExpressionBacterialPromoterPPopZAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL403
Plasmid#243721PurposeStably expresses a chimeric reporter with a mCherry (1-105aa)-XTEN250 linker-TBRG4(351aa-631aa), flanked by 5' and 3'UTRs of ALDH18A1 and no mitochondrial targeting sequenceDepositorInsertmCherry(1-105aa)-XTEN250-TBRG4(351aa-631aa), flanked by 5' and 3'UTRs of ALDH18A1 and no mitochondrial targeting sequence
UseLentiviralAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUt-mNF-Cas13d
Plasmid#224789PurposeLPUtopia matching RMCE donor plasmid with mCherry-P2A-RfxCas13d Negative-Feedback circuit. Use BlastR for positive selection and HSV-TK for negative selection.DepositorInsertmCherry-P2A-RfxCas13d
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMV-d2iAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4506
Plasmid#200255PurposePnpr-4 TeTx mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of TeTx RFPDepositorInsertTeTx
TagsmCherryExpressionWormPromoterPnpr-4Available SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4508
Plasmid#200256PurposePflp-18 LoxP EBFP LoxP TeTx mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of TeTx RFPDepositorInsertTeTx
TagsmCherryExpressionWormPromoterPflp-18Available SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-sg-1
Plasmid#190607PurposeExpresses a gRNA for base editing the EGFP Kozak sequence of pWPT-/mEGFP-1T-IRES-mCherryDepositorInsertgRNA sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pACE-GIRK2-mC-S
Plasmid#172428PurposeExpression of full-length, human GIRK4 with C-terminal mCherry StrepTag IIDepositorAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
attB53_SNCB-_attB53
Plasmid#183615PurposeRMCE vector to shuttle puromycin resistance (+), anti-GFP SynNotch receptor (+), tagBFP (-) and TRE-mCherry (-) cassettes into attP50-flanked landing pad (Addgene 183609). (+) = sense (-) = antisense.DepositorInsertsLaG17 GFP nanobody SynNotch tTA
TRE-mCherry-SV40pA
tagBFP
UseRmceTagsMyc and human CD8a signal sequenceExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
pSR11
Plasmid#69154Purposeread-outloxP mCherry to GFP switch, with fzr-1 promoter, gene and UTR, for integration on cxtTi10816, Mos Chr IVDepositorInsertsUseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterfzr-1 and rps-27Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_d23
Plasmid#59892Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with two seed sites mutatedDepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--3rd and fourth seed site removedPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_d3
Plasmid#59891Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with one seed site mutated.DepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--3rd seed site removedPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDOE20 mC VN
Plasmid#124246PurposeAllows fluorescent (mVENUS; mCherry) co-localization of two proteins in Agrobacterium- transformed plant cells.DepositorTypeEmpty backboneExpressionPlantAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDOE20 mC VN transient
Plasmid#124247PurposeAllows fluorescent (mVENUS; mCherry) co-localization of two proteins in directly-transfected plant cells.DepositorTypeEmpty backboneExpressionPlantAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
mCh-Drp1
Plasmid#49152Purposemammalian expression of Drp1 fused to mCherryDepositorAvailable SinceNov. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV-15F11-HA-mCh
Plasmid#129591PurposeThe encoded protein is the anti-HA scFv (anti-HA frankenbody) fused with the mCherry. It can be used to track mature and nascent HA tagged proteins in living organism.DepositorInsertAnti-HA frankenbody-mCherry (15F11-HA scFv-mCh)
ExpressionMammalianPromoterCMVAvailable SinceAug. 15, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
B1-INTEGRIN WT
Plasmid#195215PurposeMammalian expression of mCherry tagged B1 Integrin. Wild-type.DepositorInsertITGB1 (ITGB1 Human)
ExpressionMammalianAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
B1-INTEGRIN VN
Plasmid#195216PurposeMammalian expression of mCherry tagged B1 Integrin. Autoclustering mutant.DepositorAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJH3830
Plasmid#200038PurposePrig-3 zif-1 SL2 mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of zif RFPDepositorAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-opto-hCaspase-4 dCARD
Plasmid#208785PurposeInducibly expresses human Caspase 4 lacking the CARD domain, fused to light-activatable Cry2DepositorInsertCry2 mCherry Caspase4 dCARD (CASP4 Human)
UseLentiviralTagsCry2 mCherryExpressionMammalianMutationCARD domain is removedAvailable SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Akt-STOPS
Plasmid#175006PurposeAkt Substrate-based Tandem Occupancy Peptide Sponge. Genetically encoded for perturbing cellular Akt kinase activity.DepositorInsertmCherry-Akt-STOPS
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pH3mCHSH2
Plasmid#101053PurposeThis is a Cryptococcus neoformans mCherry expression vector with G418 drug selection marker and C. neoformans SH2 flanking sequences for genome integration.DepositorInsertCryptococcus mCherry expression plasmid
ExpressionYeastPromoterCryptococcus Histone3 promoterAvailable SinceOct. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCh-BICD2*-strep
Plasmid#120168PurposeExpresses a chimera of mCherry (fluorescent tag), a BICD2-based adaptor and streptavidinDepositorInsertBICD cargo adaptor 2 (Bicd2 Mouse)
TagsStreptavidin and mCherryExpressionMammalianMutationTruncated BICD2: 15-595 aaPromoterCMVAvailable SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
2xFKBP-mCh-KDEL
Plasmid#173010PurposeFKBP anchor for retaining DHFR-fused cargoes in the ER in the presence of zapalog. Encodes ER retrieval motif (KDEL) at C-terminus of mCherry. Contains IRES following ORF for cloning cargo.DepositorInsert2xFKBP-mCh-KDEL
TagsmCherryExpressionMammalianPromoterChicken beta actin (CAG)Available SinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNBA002
Plasmid#155324PurposeBinary vector for expression of PULSE-controlled GBP-mCherryDepositorInsertLB_(etr)8-(C120)5-PhCMVmin-GBP-mCherry-T35S_RB
UseSynthetic Biology; Eukaryotic expressionAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMJ923
Plasmid#78313PurposeExpression of His6-MBP-tagged Cas9-NLS-mCherry protein in E. coliDepositorInsertSpCas9
TagsHA-2xNLS-mCherry-NLS and His6-MBP-TEVExpressionBacterialMutationhuman codon-optimized gene sequencePromoterT7Available SinceJune 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGM32DEST
Plasmid#74747PurposeEncodes for the QF-GR recombinant gene, splice linker, and mCherry reporter geneDepositorInsertsTagsFusion of the Neurospora crassa QF activator to t…ExpressionWormPromoterNo promoterAvailable SinceOct. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHD157
Plasmid#84033PurposeVector for creating transgenic zebrafish. Expresses mCherry-Cre fusion protein under the fabp10 promoter and Venus under the crystalin promoter in zebrafishDepositorInsertsCre
Venus
UseCre/Lox; Zebrafish transgenesisTagsmCherryPromoterCrystalin and fabp10Available SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
ROSA26(MultiFPsΔPuro)
Plasmid#140759PurposeTargeting vector to Gt(ROSA)26 locus for conditional expression of distinct FPs (Venus, mCherry, and mCerulean) responding to each site-specific-recombinase activity (Cre, Dre, and phiC31o).DepositorInsertspuromycin-N-acetyltransferase
Venus
mCherry
mCerulean
UseMouse TargetingPromoterCAGGSAvailable SinceJune 16, 2020AvailabilityAcademic Institutions and Nonprofits only