We narrowed to 11,061 results for: AGA
-
Plasmid#190181PurposeFluorescent reporter vector to visualize all of cell cycle phases.DepositorInsertsExpressionBacterial and MammalianPromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pLEX-307_LgBiT
Plasmid#191211PurposeLentiviral-mediated stable expression of LgBiT for slit nanoluciferase complementation assays in mammalian cellsDepositorInsertLgBiT (large bit)
UseLentiviral and LuciferaseMutationAB030246.1 (mutated in PMID 26569370)Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4f-NGR-WPRE
Plasmid#234438PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorHas ServiceAAV1InsertiGluSnFR4f-NGR
UseAAVTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-NUP98-HOXA9
Plasmid#237639PurposeFor overexpression of mEGFP-NUP98-HOXA9DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30D
Plasmid#214672PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs downstream of the 5′ splice siteDepositorInsertMAPT (MAPT Human)
TagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30U
Plasmid#214673PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs upstream of the 3′ splice siteDepositorInsertMAPT (MAPT Human)
TagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPD0055_pIVTRup_MS2-p65-HSF1
Plasmid#242541PurposeIVTDepositorAvailable SinceNov. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-MPSV-eBFP2
Plasmid#220472PurposeExpresses either functional CRISPR gRNAs from the hU6-promotor and empowers pairing of CRISPR screens with 3' and 5' scRNA-Seq capturing by FACS-sorting on eBFP2+ without prior resistance selectionDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-SFFV-eBFP2
Plasmid#239601PurposeExpresses either functional CRISPR gRNAs from the hU6-promotor and empowers pairing of CRISPR screens with 3' and 5' scRNA-Seq capturing by FACS-sorting on eBFP2+ without prior resistance selectionDepositorInsertspleen focus‑forming virus - promotor
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-mRuby3-Gal8-P2A-Zeo
Plasmid#150815PurposeMammalian expression of mRuby3-Galectin8 (Gal8) fusion proteinDepositorInsertmRuby3-Gal8-P2A-Zeo (LGALS8 Synthetic, Human)
TagsGal8 is fused to the c-terminus of mRuby3ExpressionMammalianPromoterCAGAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-RfxCas13d-HA
Plasmid#141320PurposePlasmid to carry out IVT of RfxCas13d (human codon-optimized)DepositorInsertRfx-Cas13d
UseCRISPRTagsHAAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDL52 (clone76)
Plasmid#188579PurposeHigh-yield production of coenzyme F420 in E. coliDepositorInsertsribA
ribD
yigB
fbiC
cofC
cofD
cofI
cofE
ExpressionBacterialMutationCodon optimization, synthetic ribosome binding si…PromoterT7 variantsAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-SMARCA4
Plasmid#65391PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase INF enhancer vector_ORI_ISG15
Plasmid#99322PurposeLuciferase validation vector with ISG15 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr1: 947976 -949995 (ISG15 Human)
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCaggs-mGold2s
Plasmid#231763PurposeExpression of mGold2s in mammalian cellsDepositorInsertmGold2s
ExpressionMammalianMutationmGold2s is mGold with V1A;V22I;H77N;Q80R;K101E;D1…PromoterActin promoter with CMV enhancerAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgLATS1/2-2
Plasmid#229432Purposeknockout of LATS1 and LATS2DepositorUseCRISPR and LentiviralExpressionMammalianPromoterhU6;bU6;EFSAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-NUP98-DDX10-KS
Plasmid#237644PurposeFor overexpression of mEGFP-NUP98-DDX10-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-NUP98-DDX10
Plasmid#237640PurposeFor overexpression of mEGFP-NUP98-DDX10DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7 FLAG-YAP1-TEAD-P-H2B-mCherry
Plasmid#128327PurposeReporter to evaluate YAP1/TEAD-mediated gene transcriptionDepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Fucci(CA) hCdt1-iRFP hGeminin-iRFP
Plasmid#190182PurposeFluorescent reporter vector for visualization of G0 and other cell cycle phases.DepositorInsertsExpressionBacterial and MammalianPromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-iGluSnFR4f-PDGFR-WPRE
Plasmid#234446PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterGFAPAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-RfxCas13d-His
Plasmid#141322PurposePlasmid for bacterial expression and purification of RfxCas13d proteinDepositorInsertRfx-Cas13d
UseCRISPRTags6xHisExpressionBacterialPromoterT7Available SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iGluSnFR4f-PDGFR-WPRE
Plasmid#234450PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterCAGAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNCS-mGold2t
Plasmid#231766PurposeExpression of mGold2t in bacterial cellsDepositorInsertmGold2t
ExpressionBacterialMutationmGold2t is mGold with V1A;V22I;H77N;Q80R;K101E;D1…PromoterSynthetic promoterAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpp1-is2
Plasmid#58248PurposeExpression vector producing isoform 2 derived mouse osteopontin (EGFP tagged)DepositorAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-NUP98-HOXA9-KS
Plasmid#237673PurposeFor overexpression of mEGFP-NUP98-HOXA9-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-RfxCas13d-NLS-HA
Plasmid#141321PurposePlasmid to carry out IVT of RfxCas13d-NLS (human codon-optimized)DepositorInsertRfx-Cas13d (NLS-RfxCas13d-NLS)
UseCRISPRTagsHA and NLSAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-TAF1
Plasmid#65395PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-iGluSnFR4s-PDGFR-WPRE
Plasmid#234445PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterGFAPAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 Sox2 HM a
Plasmid#26353DepositorInsertSox2 shRNA
UseLentiviral and RNAiExpressionMammalianAvailable SinceSept. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-YAP-MAMLD1
Plasmid#237675PurposeFor overexpression of mEGFP-YAP-MAMLD1DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-YAP-MAML2
Plasmid#237674PurposeFor overexpression of mEGFP-YAP-MAML2DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT2-shP53
Plasmid#124261PurposeExpresses shRNA targeting P53. Construct has inverted repeats to be used in Sleeping beauty system.DepositorInsertshP53
ExpressionMammalianAvailable SinceApril 8, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti-CMV-Puro-PNPT1
Plasmid#223315PurposeLentiviral vector expressing human PNPT1DepositorInsertPolyribonucleotide Nucleotidyltransferase 1 (PNPT1 Human)
UseLentiviralExpressionMammalianAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNeg-Ma-barnase-TAG3-TAG45
Plasmid#197572PurposeNegative selection plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses 2xTAG-codon interrupted barnase gene and M. alvus Pyl-tRNA(6). p15a origin of replication.DepositorInsertsBarnase - 2xTAG
M. alvus Pyl-tRNA (6)
TagsnoneExpressionBacterialMutation3TAG and 45TAGPromoteraraC and lppAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV_ACE2-Flag_Hygro
Plasmid#191998PurposeLentiviral vector to generate flag-tagged ACE2 stable expressing cell lineDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-TAZ-CAMTA1
Plasmid#237642PurposeFor overexpression of mEGFP-TAZ-CAMTA1DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMini-CMV-NLS-dead R-IscB-NLS_T2A_mCherry_U1a-EGFP trans-splicing ωRNA
Plasmid#246436PurposeExpresses R-IscB with EGFP-repairing ωRNA in mammalian cells for trans-splicing assessments.DepositorInsertsO.gue IscB with dead mutations (D60A, H269A) and delta-TID
mCherry
ωRNA with trans-splicing template
TagsGFP N-terminal sequence (M1 to Q95), Hemi Intron …ExpressionMammalianMutationGFP N-terminal sequence M1 to Glutamine 95 append…PromoterCMV and U1aAvailable SinceOct. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4f-PDGFR-WPRE
Plasmid#234436PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT7NT*-Bri2 113-231 R221E
Plasmid#138134PurposeExpresseds human Bri2 BRICHOS R221E mutant in E. coliDepositorInserthuman Bri2 BRICHOS R221E (ITM2B Human)
TagsNT* tag derived from spider silk proteinsExpressionBacterialPromoterT7Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PARP1_D770A-mCherry
Plasmid#192260PurposeExpresses PARP1 D770A mutant in mammalian cells. Tagged with mCherry.DepositorAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PARP1_R878A-mCherry
Plasmid#192261PurposeExpresses PARP1 R878A mutant in mammalian cells. Tagged with mCherry.DepositorAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X
Plasmid#225718PurposeBacterial expression of USP27X with HA tagDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPos-Ma-CmR-TAG111
Plasmid#197571PurposePositive selection plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses TAG-codon interrupted chloramphenicol resistance cassette and M. alvus Pyl-tRNA(6). p15a oriDepositorInsertsChloramphenicol resistance gene - 111TAG
T7 polymerase -TAG
GFPuv
M. alvus Pyl-tRNA(6)
ExpressionBacterialMutation111TAG and 8TAG/112TAGPromoterAraC, T7, cat promoter (constitutive), and lpp (c…Available SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTBL227 NheI-Cas9-KpnI-5xFlag-FseI-TdT-NotI
Plasmid#126477PurposeExpresses Cas9-5xFlag-TdT in mammalian cells.DepositorInsertsExpressionMammalianMutationChanged codons to reduce repetitive sequences.PromoterCMVAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4s-PDGFR-WPRE
Plasmid#234435PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTAHR TH-p2a-TD:Tomato (floxed selection Puro)
Plasmid#135814PurposeFluorescent reporter for knock-in of TdTomato into the TH locusDepositorInsertTH-p2a-TD:Tomato (red fluorophore protein) construct as a reporter for TH expression. (TH Human)
Tagsp2a-TdTomatoExpressionMammalianAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCaggs-mGold2t
Plasmid#231764PurposeExpression of mGold2t in mammalian cellsDepositorInsertmGold2t
ExpressionMammalianMutationmGold2t is mGold with V1A;V22I;H77N;Q80R;K101E;D1…PromoterActin promoter with CMV enhancerAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only