Skip to main content

We narrowed to 18,379 results for: Met

Showing: 2501 - 2520 of 18379 results
  1. M-tdTom-NM

    Plasmid
    #48679
    Purpose
    Mammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacer
    Depositor
    Insert
    TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
    Use
    CRISPR
    Promoter
    Sp6
    Available Since
    Oct. 22, 2013
    Availability
    Academic Institutions and Nonprofits only
Showing: 2501 - 2520 of 18379 results