-
Plasmid#219925PurposePrFBA with the overhangs for SapI restriction site can be insert into the base plasmid of TUNEYALIDepositorInsertPromoter FBA
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMIMY
Plasmid#191954PurposeA pMSCV-based backbone where the MCS has been substituted with a MCS-IRES-mitoYFP for expression of a gene of interest and a mitochondrially targeted YFPDepositorTypeEmpty backboneUseRetroviralTagsExpressionMutationPromoterAvailable sinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorA(sp)-mNeonGreen
Plasmid#205020PurposeBroad host-range bacterial expression vector with constitutive Pc promoter. Provides E. coli TorA signal peptide in frame with mNeonGreen (codon optimized for expression in P. fluorescens); for targeting mNeonGreen to the periplasmDepositorInsertTorA-mNeonGreen
UseTagsExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPcAvailable sinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-dCas9-VP64-6xHis
Plasmid#62935PurposeExpression of dCas9-VP64-6xHis in bacterial cellsDepositorInsertdCas9-VP64
UseTags3xFLAG, 6xHis, NLS, and VP64ExpressionBacterialMutationD10A and H840A amino acid changes render Cas9 nuc…PromoterT7Available sinceMay 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCWori cytochrome P450-BM3h 9D7
Plasmid#61308PurposeExpresses Cytochrome P450-BM3h 9D7 with C-terminal 6-His tagDepositorInsertCytochrome P450-BM3 heme domain 9D7
UseTags6xHisExpressionBacterialMutationT268A, I263A, T438V, A328GPromoterTacAvailable sinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-LAMP1
Plasmid#207788PurposeDonor template for moxGFP-2A-Puro insertion into the C-terminus of the LAMP1 locus. For lysosome visualization.To be co-transfected with sgRNA plasmid px330-LAMP1 (Addgene #207787)DepositorInsertLAMP1 Homology Arms flanking a moxGFP-Puro Cassette (LAMP1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceDec. 1, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Blast-3xFLAG-LMNB1
Plasmid#207777PurposeDonor template for Blast-2A-3xFLAG insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-3xFLAG Cassette (LMNB1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLL3.7 EGFPC2 TAZ
Plasmid#66850PurposeExpress GFP-fused TAZ by lentivirusDepositorInsertWWTR1/TAZ (WWTR1 Human)
UseTagsGFPExpressionMammalianMutationPromoterCMVAvailable sinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG-CBE4max-SpRY-P2A-EGFP (RTW5133)
Plasmid#139999PurposeCAG promoter expression plasmid for human codon optimized BE4max C-to-T base editor with SpRY(D10A/A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1322R/R1333P/R1335Q/T1337R) and P2A-EGFPDepositorInserthuman codon optimized CBE4max SpCas9 variant named SpRY with P2A-EGFP
UseCRISPRTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpRY=A61R/L1111R/D1135L/S1136W/G121…PromoterCAGAvailable sinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
His6-pAG-RTase
Plasmid#214932PurposeExpress fusion proteins of Protein A/G and MMLV reverse transcriptase (25-497) in bacterial systemsDepositorInsertfusion protein of protein A/G and MMLV reverse transcriptase (25-497)
UseTagsHis6ExpressionBacterialMutationMMLV RTase (H8Y, D200N, T306K, W313F, T330P, D524…PromoterT7 promoterAvailable sinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC13N-dCas9-BFP-KRAB
Plasmid#127968Purposeconstitutive expression of dCas9-BFP-KRAB from the CLYBL locus (Ward lab)DepositorInsertCLYBL-CAG-dCas9-NLS-BFP-KRAB
UseTALENTagsExpressionMammalianMutationPromoterCAGAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTP298 His14-Avi-27xGS-SUMOEu-2xGS-anti ALFA tag nanobody
Plasmid#199390PurposeBacterial expression plasmid for anti-ALFA nanobody with an N-terminal His-tag, biotin acceptor peptide (Avi), and SUMOEu tagDepositorInsertanti-ALFA nanobody
UseTags14xHis-Avi-SUMOEuExpressionBacterialMutationPromoterT5-LacOAvailable sinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPRKCZ-C1-EGFP (C-PRKCZ-C1)
Plasmid#217759PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertProtein kinase C zeta (PRKCZ Human)
UseTagsEGFPExpressionMammalianMutationC1 domain (aa 123-193)PromoterCMVAvailable sinceJune 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
N1-Tq-Ca-FLITS
Plasmid#191454PurposeGenetically encoded calcium sensor (GECI) Tq-Ca-FLITS that reports with lifetime and intensity changesDepositorInsertTq-Ca-FLITS
UseTagsExpressionMammalianMutationPromoterAvailable sinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-SpdCas9-KRAB-tagBFP-PGK-Blasticidin
Plasmid#187953PurposeFKBP12 (F36V mutant) degron-tagged dCas9-KRAB domain fused to tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-SpdCas9-KRAB-tagBFP
UseCRISPR and Synthetic BiologyTagsGGSExpressionMammalianMutationPromoterAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-KRAB-SpdCas9-tagBFP-PGK-Blasticidin
Plasmid#187957PurposeFKBP12 (F36V mutant) degron-tagged KRAB-dCas9 fused with tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-KRAB-SpdCas9-tagBFP
UseCRISPR and Synthetic BiologyTagsGGSExpressionMammalianMutationPromoterAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-EGFP-GRAM-W
Plasmid#211704PurposeLentiviral expression of EGFP-tagged GRAM domain of GRAMD1b carrying a G187W mutation (pLJM1-EGFP-GRAM1b G187W)DepositorInsertEGFP-tagged GRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
UseLentiviralTagsEGFPExpressionMammalianMutationChanged Glycine 187 to TryptophanPromoterCMVAvailable sinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-LivePAR-Hygro
Plasmid#176063PurposeEGFP fused to the C-terminus of a WWE domain & a hygromycin resistance cassetteDepositorInsertLivePAR
UseLentiviralTagsEGFPExpressionMammalianMutationPromoterEF1AAvailable sinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
B-GRAM-W
Plasmid#211707PurposeExpression of a dimerization-dependent fluorescent protein (ddFP) subunit (B) fused with the GRAM domain of GRAMD1b carrying a G187W mutation (B-GRAM-W) in mammalian cellsDepositorInsertB-tagged GRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
UseTagsddFP-B3ExpressionMammalianMutationChanged Glycine 187 to TryptophanPromoterCMVAvailable sinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
PM-RA
Plasmid#211705PurposeExpression of a dimerization-dependent fluorescent protein (ddFP) subunit (RA) fused with plasma membrane (PM) targetting motif of Lck in mammalian cellsDepositorInsertPM-targetted RA (Lck Synthetic)
UseTagsRAExpressionMammalianMutationPromoterCMVAvailable sinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV_hU6-sgRNA_hUbC-dCas9-ZIM3-KRAB-T2a-PuroR
Plasmid#172982Purposecontrol & cloning vector for CRISPRi expressing dead Cas9-ZIM3-KRAB fusionDepositorInsertcontrol sgRNA
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
B-GRAM-H
Plasmid#211706PurposeExpression of a dimerization-dependent fluorescent protein (ddFP) subunit (B) fused with the GRAM domain of GRAMD1b carrying a G187L mutation (B-GRAM-H) in mammalian cellsDepositorInsertB-tagged GRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
UseTagsddFP-B3ExpressionMammalianMutationChanged Glycine 187 to LeucinePromoterCMVAvailable sinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T7-6h-GST-α-Synuclein
Plasmid#225224PurposeAlpha synuclein gene fused with gst gene under t7 promoter for bacterial expression of alpha synuclein protein.DepositorInsertsGST
α-Synuclein
UseTags6xHis Tag and TEV Cleavage SiteExpressionBacterialMutationPromoterT7Available sinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV TRE3G Neo GFP-Progerin
Plasmid#118710PurposeLentiviral TET-ON inducible GFP-ProgerinDepositorInsertGFP-Progerin (LMNA Human)
UseLentiviral; Tet-on inducibleTagsGFPExpressionMammalianMutationPromoterCMV TRE3G (TET-ON)Available sinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax(7.10)-SpCas9-NG-P2A-EGFP (RTW4564)
Plasmid#140005PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with SpCas9-NG(D10A/L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) SpCas9-NG with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpCas9-NG=L1111R/D1135V/G1218R/E121…PromoterCMV and T7Available sinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-CANX
Plasmid#227281PurposeDonor template for mStayGold-2A-Puro insertion into the C-terminus of the CANX locus. For cilia visualization. To be co-transfected with sgRNA plasmid px330-CANX (Addgene #227279)DepositorInsertCANX Homology Arms flanking a mStayGold-2A-Puro Cassette (CANX Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
EGFP-GRAM-W
Plasmid#211701PurposeExpression of EGFP-tagged GRAM domain of GRAMD1b carrying a G187W mutation (EGFP-GRAM1b G187W) in mammalian cellsDepositorInsertGRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
UseTagsEGFPExpressionMammalianMutationChanged Glycine 187 to TryptophanPromoterCMVAvailable sinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP1
Plasmid#79873PurposeBacillus subtilis dCas9 expression vector; integrates into lacA/ganADepositorInsertdCas9
UseCRISPRTagsExpressionBacterialMutationD10A, H840APromoterxylAAvailable sinceOct. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJMP3
Plasmid#79875PurposeBacillus subtilis sgRNA expression vector; integrates into thrCDepositorInsertsgRNA RR1
UseCRISPRTagsExpressionBacterialMutationPromotervegAvailable sinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-dCas9
Plasmid#112233PurposeLentiviral plasmid for expression of gRNA and dCas9 in mammalian cells; derivative of lentiCRISPR v2DepositorInsertsdCas9
Porumycin resistance
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationChanged: Aspartic acid 10 to Glycine, Histidine 8…PromoterEFS-NSAvailable sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
DD-Cas9 with filler sequence and Cre-ERT2 (EDCICE)
Plasmid#90086PurposeThis plasmid contains destabilized Cas9 and has Cre-ERT2 after IRES sequence. This vector also contains filler sequence which required to be removed for cloning of desired sgRNADepositorInsertCas9
UseCRISPR and LentiviralTagsDestabilized Domain and FlagExpressionMammalianMutationPromoterEFSAvailable sinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVX-dL5**-mCER-TRF1
Plasmid#168176PurposeExpresses FAP (dL5**) fused to mCerulean and the telomere binding protein TRF1DepositorInsertTRF1 (TERF1 Human)
UseLentiviralTagsFAP (dL5**) and mCeruleanExpressionMammalianMutationPromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA CFP hNKCC1 WT (NT15-H)
Plasmid#49077PurposeExpresses human NKCC1 with an N-terminal 3xHA-CFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites. Native hNKCC1 amino acid sequenceDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
UseTags3x HA and mCeruleanExpressionMammalianMutation262 silent mutations from native hNKCC1PromoterCMVAvailable sinceNov. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV7.1_3xFLAG-LATS2
Plasmid#172987Purposeconstitutive expression of FLAG-tagged LATS2DepositorInsert3xFLAG-LATS2 (LATS2 Human)
UseTags3xFLAGExpressionMammalianMutationPromoterAvailable sinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPGK-T7/2-CD44v3 (fl)
Plasmid#137814Purposeexpression of CD44 proteins in mammalian cellsDepositorInsertCD44v3 (fl) (CD44 Human)
UseTagsGFPExpressionMammalianMutationfull length and N280D in the V3 regionPromoterPGKAvailable sinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGLOW31
Plasmid#172698PurposeC. elegans mScarlet co-injection markerDepositorInsertPmyo-3::mScarlet
UseTagsmScarletExpressionWormMutationPromotermyo-3Available sinceAug. 30, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pNOC_hfnCas12a_CRATES
Plasmid#176251PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and type IIS restriction site for endonuclease BaeI at the crRNA region that facilitates the generation of mulitplDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationPromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin2a KI
Plasmid#131486PurposeEndogenous tagging of GluN2a: N-terminal (amino acid position: A25)DepositorInsertgRNA and GFP donor (Grin2a Rat)
UseTagsExpressionMammalianMutationPromoterU6 and CbhAvailable sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEF_PE2
Plasmid#199267PurposeMammalian expression of SpCas9 prime editor 2 under EF1α promoterDepositorInsertPE2-P2A-mp53DD
UseTagsExpressionMammalianMutationΔ40-903PromoterAvailable sinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_Nlux_(-HH)crRNA NR1
Plasmid#176250PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1 without the hammerhead ribozymDepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…TagsExpressionMutationPromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
DD-Cas9 with filler sequence and Venus (EDCPV)
Plasmid#90085PurposeThis plasmid contains destabilized Cas9 and has Venus after P2A sequence. This vector also contains filler sequence which required to be remove for cloning of desired sgRNADepositorInsertCas9
UseCRISPR and LentiviralTagsDestabilized Domain and FlagExpressionMammalianMutationPromoterEFSAvailable sinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
enIscB-T5E
Plasmid#205411PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB fused with T5E at C-terminal driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_XTEN_T5E_npNLS_pU6__RNA*_pCMV_mCherry
UseTagsExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable sinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-COX8A
Plasmid#227309PurposeDonor template for mStayGold insertion into the C-terminus of the COX8A locus. For mitochondria visualization. To be co-transfected with sgRNAplasmid px330-PITCh-COX8A (Addgene #227308)DepositorInsertCOX8A Homology Arms flanking a mStayGold Tag (COX8A Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-COX8A
Plasmid#227308PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of COX8A for knock-in.DepositorInsertsgRNA Targeting C-terminus of COX8A (COX8A Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU67Available sinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-LAMP1
Plasmid#227322PurposeDonor template for mStayGold insertion into the C-terminus of the LAMP1 locus. For lysosome visualization. To be co-transfected with sgRNA plasmid px330-LAMP1 (Addgene #207787)DepositorInsertLAMP1 Homology Arms flanking a mStayGold Tag (LAMP1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-CLTC
Plasmid#227314PurposeDonor template for mStayGold-2A-Puro insertion into the C-terminus of the CLTC locus. For clathrin heavy chain visualization. To be co-transfected with sgRNA px330-PITCh-CLTC (Addgene #227312)DepositorInsertCLTC Homology Arms flanking a mStayGold-2A-Puro Cassette (CLTC Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-PEX3
Plasmid#227304PurposeDonor template for mStayGold insertion into the C-terminus of the PEX3 locus. For peroxisome visualization. To be co-transfected with sgRNA plasmid px330-PITCh-PEX3 (Addgene #227303)DepositorInsertPEX3 Homology Arms flanking a mStayGold Tag (PEX3 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-RAB7A
Plasmid#227298PurposeDonor template for mStayGold insertion into the N-terminus of the RAB7A locus. For endosome visualization. To be co-transfected with sgRNA plasmid px330-RAB7A (Addgene #227297)DepositorInsertRAB7A Homology Arms flanking a mStayGold Tag (RAB7A Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only