We narrowed to 11,225 results for: Kars
-
Plasmid#148617PurposeBacterial Expression of HsNot9_19-285-V181EDepositorInsertHsNot9_19-285-V181E (CNOT9 Human)
ExpressionBacterialAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot9-shRNAres2_W
Plasmid#147905PurposeMammalian Expression of HsNot9-shRNAres2DepositorInsertHsNot9-shRNAres2 (CNOT9 Human)
ExpressionMammalianAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NpM-HsNot1iso1_1356-1581_V
Plasmid#147779PurposeBacterial Expression of HsNot1iso1_1356-1581DepositorInsertHsNot1iso1_1356-1581 (CNOT1 Human)
ExpressionBacterialAvailable SinceMarch 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRB131
Plasmid#180174PurposepAAV construct GluN1A714L (shRNA resistant)DepositorAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSUMO R106L-CPTP
Plasmid#170737PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSUMO K60A-CPTP
Plasmid#170736PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone2
Plasmid#162123PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
p1A Prk-
Plasmid#162694Purposep1A negative control expressing CbbLS and inactive Prk (Prk K20M S21A)DepositorInsertH. neapolitanus CbbLS and S. elongatus Prk
TagsN terminal 6x His tag on PRKExpressionBacterialMutationPrk inactive (K20M S21A native protein, this map …PromoterPLtet0-1 promoterAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone3
Plasmid#162124PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
FUS_LC_charge_RtoK
Plasmid#139127Purposeexpress FUS LC with hnRNPA2-like charge patterning where all R are changed to KDepositorInsertFUS (FUS Human)
ExpressionBacterialMutationAdd K and D to FUS LC so it has the same charge p…Available SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
prCOrev
Plasmid#153961PurposeUsed to detect crossover-type DNA recombination events elicited by iso-positional nicking of two homologous DNA fragments (recombination analogous to Holliday's model)DepositorInsert5' and 3' EGFP fragments sharing a 386-bp sequence, separated by a NeoR gene cassette and arranged in the opposite direction
UseRetroviral; A reporter plasmid detecting dna reco…TagsNLS-ZFExpressionMammalianMutationNo mutationPromoterLTRAvailable SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
prCO
Plasmid#153960PurposeUsed to detect crossover-type DNA recombination events elicited by iso-positional nicking of two homologous DNA fragments (recombination analogous to Holliday's model)DepositorInsert5' and 3' EGFP fragments sharing a 386-bp sequence, separated by a NeoR gene cassette and arranged in the same direction
UseRetroviral; A reporter plasmid detecting dna reco…TagsNLS-ZFExpressionMammalianMutationNo mutationPromoterLTRAvailable SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJT175_GalL_A3A(Y130F)Δ186-BE3
Plasmid#145124PurposeExpressing base editor A3A(Y130F)Δ186-BE3 in yeast cellsDepositorInsertA3A(Y130F)Δ186-BE3
UseCRISPRExpressionYeastMutationA3A(Y130F; 1-186AA); spCas9(D10A)PromoterGalLAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-N entry vector
Plasmid#111751PurposeIntermediate vector containing HTT gene, except for polyQ region. Used to clone various polyQ lengths into HTT sequence with N-term FLAG tag. Baculovirus transfer vector for insect and mammalian cellsDepositorTypeEmpty backboneUseBaculovirus expressionTagsFLAGExpressionMammalianAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Pur-Lyn-AktAR2
Plasmid#125197PurposeSB-transposon plasmid for stable expression of lipid raft-targeted Lyn-AktAR2 variant of FRET-based AKT activity reporterDepositorInsertLyn-AktAR2
UseTransposonTagsLyn tag (GCIKSKRKD), mCerulean3 and cpVenus[E172]ExpressionMammalianPromoterEF1a/RPBSAAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PHF21A__CAMK1D
Plasmid#116831PurposeLentiviral expression of PHF21A__CAMK1D fusionDepositorInsertPHF21A__CAMK1D
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PRKCE__CAMKMT
Plasmid#116832PurposeLentiviral expression of PRKCE__CAMKMT fusionDepositorInsertPRKCE__CAMKMT
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTK2__NCR3
Plasmid#116834PurposeLentiviral expression of PTK2__NCR3 fusionDepositorInsertPTK2__NCR3
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-QKI__PACRG
Plasmid#116835PurposeLentiviral expression of QKI__PACRG fusionDepositorInsertQKI__PACRG
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-CDK6__HEPACAM2
Plasmid#116812PurposeLentiviral expression of CDK6__HEPACAM2 fusionDepositorInsertCDK6__HEPACAM2
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-DUSP22__PTK7
Plasmid#116814PurposeLentiviral expression of DUSP22__PTK7 fusionDepositorInsertDUSP22__PTK7
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-GSK3A__ZNF564
Plasmid#116820PurposeLentiviral expression of GSK3A__ZNF564 fusionDepositorInsertGSK3A__ZNF564
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IDE__CAMK1D
Plasmid#116823PurposeLentiviral expression of IDE__CAMK1D fusionDepositorInsertIDE__CAMK1D
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IKBKB__ANK1
Plasmid#116824PurposeLentiviral expression of IKBKB__ANK1 fusionDepositorInsertIKBKB__ANK1
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-MAP2K5__IQCH
Plasmid#116826PurposeLentiviral expression of MAP2K5__IQCH fusionDepositorInsertMAP2K5__IQCH
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_KLF8_P2A_Hygro_Barcode
Plasmid#120494PurposeBarcoded lentiviral vector to express KLF8 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
GST-beta2(616-951)Double
Plasmid#100746PurposeBacterial expression of GST-tagged beta2 subunit of AP2 complex (hinge and ear) long splice form, mutantDepositorInsertAP2B1 (AP2B1 Human)
TagsGSTExpressionBacterialMutationLong isoform with deletion of clathrin binding mo…Available SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
GST-beta2(616-951)Y815A
Plasmid#100744PurposeBacterial expression of GST-tagged beta2 subunit of AP2 complex (hinge and ear) long splice form, mutantDepositorAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
GST-beta2(616-951)∆CBM
Plasmid#100745PurposeBacterial expression of GST-tagged beta2 subunit of AP2 complex (hinge and ear) long splice form, mutantDepositorInsertbeta2 adaptin (AP2B1 Human)
TagsGSTExpressionBacterialMutationLong isoform with deletion of clathrin binding mo…Available SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1-OSF-TRIM5alpha(African green monkey pygerythrus)(1-293)
Plasmid#79030PurposeBaculoviral entry vector to produce Bac-to-bac baculovirusesDepositorInsertOSF-TRIM5alpha(African green monkey pygerythrus)(1-293)
TagsOneSTrEP-FLAGExpressionInsectMutationdeleted amino acid 294-515 from frican green monk…PromoterpolyhedrinAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQCXIX_sh_hMIB2_#9
Plasmid#75255Purposeretroviral shRNA vector against human MIB2, expresses GFP for transduction controlDepositorInsertshRNA against MIB2 (human) (MIB2 Human)
UseRNAi and RetroviralExpressionMammalianPromotermU6Available SinceJune 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETDuet_6xHis-FKBP8(1-391aa)-thrombin-GST
Plasmid#227712PurposeExpression of recombinant protein for purificationDepositorInsertFKBP8(1-391aa) (FKBP8 Human)
ExpressionBacterialAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PEmax
Plasmid#174820PurposeMammalian expression of SpCas9 PEmax prime editorDepositorInsertPEmax
TagsSV40 bpNLS and c-Myc NLSExpressionMammalianMutationDetailed in manuscriptPromoterCMVAvailable SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTCH1
Plasmid#116779PurposeLentiviral expression of PTCH1DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT7-PEmax for IVT
Plasmid#178113PurposeTemplate for in vitro transcription of PEmaxDepositorInsertPEmax
UseTemplate for in vitro transcriptionTagsSV40 bpNLS and c-Myc NLSMutationDetailed in manuscriptPromoterT7 (inactivated)Available SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ROR1
Plasmid#116789PurposeLentiviral expression of ROR1DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV enAsCas12f-HKRA-sgRNA_v7
Plasmid#208357PurposeExpression of enAsCas12f-HKRA and sgRNA_v7 in mammalian cellsDepositorInsertenAsCas12f-HKRA
ExpressionMammalianMutationI123H/D195K/D208R/V232APromoterCMVAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR2
Plasmid#167001PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR1
Plasmid#167000PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only