We narrowed to 12,964 results for: BASE
-
Plasmid#175065Purposeexpresses mVenus and mCherry tagged DNAJB6b in mammalian cellsDepositorInsertDNAJB6b (DNAJB6 Human)
TagsV5 and mVenus + mCherryExpressionMammalianMutationmVenus: C-Terminal deletion of 11 aa (GITLGMDELYK…PromoterCMV PromoterAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.H1-NP
Plasmid#134367PurposeNanoluc complementation assay. Expression of histamine receptor H1 fused at C termimus with Natural peptide (NP) of NanoLuc. Addition of the Flag epitope at N terminus of H1 receptor.DepositorInsertH1-NP (HRH1 Human)
TagsFlag and natural peptide of nanoluciferaseExpressionBacterial and MammalianPromoterT7Available SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:MS2:VPR:Tnos (GB1830)
Plasmid#160624PurposeTU for the constitutive expression of the MS2 coat protein fused on Ct to the activation domain VPR (VP64+p65+Rta)DepositorInsertP35S:MS2:VPR:Tnos
ExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Rims2-GFP KI
Plasmid#131495PurposeEndogenous tagging of RIM2: C-terminal (amino acid position: S1551)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
SOX17-NLS-tdTomato-EPG
Plasmid#210466PurposeDonor plasmid for knock-in NLS-tdTomato into the human SOX17 locusDepositorInsertSOX17 homologous recombination arms with a NLS-tdTomato and EF1alpha-drived puromycin-EGFP selection cassette (SOX17 Human)
UseCRISPRAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET24a-VHH-2xTS
Plasmid#109419PurposeBacterial expression of a functionalized anti-GFP (VHH) nanobody fused to two tyrosine sulfation (TS) motifs. VHH-2xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-GFP nanobody fused to a T7, TS, HA, BAP and His6 epitope
TagsBAP, HA, His6, T7, and Tyrosine sulfation (TS) se…ExpressionBacterialPromoterT7Available SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-3xHA-LMNB1
Plasmid#207778PurposeDonor template for Blast-2A-3xHA insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-3xHA Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Puro-sTagRFP-TUBA1B
Plasmid#207769PurposeDonor template for Puro-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Puro-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BG505.SOSIP-gp160-QES.i05.c06
Plasmid#123276PurposeMammalian expression plasmid for Env from the BG505 HIV-1 isolate (containing SOSIP mutations); QES mutant for enhanced presentation of quaternary epitopesDepositorInsertHIV-1 (BG505) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; SOSIP mutations; …PromoterCMVAvailable SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP302-pAAV-CMV-dSaCas9-KRAB-pA
Plasmid#113677PurposeA CMV driven de-catalyzed SaCas9 fused to KRAB domain for inhibition of transcription in targeted region.DepositorInsertde-catalyzed SaCas9
UseAAV and CRISPRTagsKRAB and NLSAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMG81-MBP-t-M.MpeI-N374K-His
Plasmid#197985PurposeExpresses CpG Carboxymethyltransferase (M.MpeI N374K) in bacteria. The gene also encodes an N-terminal (TEV cleavable) MBP tag as well as C-terminal His tag.DepositorInsertMBP-t-M.MpeI-N374K-His
TagsHis and MBPExpressionBacterialMutationM.MpeI-N374KAvailable SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:MS2:TV:Tnos (GB2048)
Plasmid#160627PurposeTU for the constitutive expression of Ms2 fused to TV (TALx6 - VP128) activation domainsDepositorInsertP35s-MS2:TV-Tnos
ExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-ecDHFR-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187950PurposeecDHFR degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertecDHFR-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Shank2-GFP KI
Plasmid#131496PurposeEndogenous tagging of Shank2: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-ER50-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187948PurposeER50 degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertER50-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianMutation6 mutations, T371A, L384M, M421G, G521R, Y537S, N…Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CLTC
Plasmid#227313PurposeDonor template for mStayGold insertion into the C-terminus of the CLTC locus. For clathrin heavy chain visualization. To be co-transfected with sgRNA px330-PITCh-CLTC (Addgene #227312)DepositorInsertCLTC Homology Arms flanking a mStayGold Tag (CLTC Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax(7.10)-xCas9(3.7)-P2A-EGFP (RTW4644)
Plasmid#140004PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with xCas9(3.7)(D10A/A262T/R324L/S409I/E480K/E543D/M694I/E1219V) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) xCas9(3.7) with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; xCas9(3.7)=A262T/R324L/S409I/E480K/…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAG27
Plasmid#226742PurposeExpresses a reporter for a mitochondrial matrix proteinDepositorAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJEP309-pAAV-EFS-dSaCas9-KRAB-Dio-pA
Plasmid#113686PurposeAn EFS driven inverted de-catalyzed SaCas9 fused to the transcription repressor KRAB. dSaCas9-KRAB is floxed to render the system cre-dependent.DepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Cre/LoxTagsKRABAvailable SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.SYFP2-POST-T2A-dTomato.FLEX.WPRE.SV40
Plasmid#105983PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular SYFP2 fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-SYFP2-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsSYFP2-POST, T2A-dTomato, and mycExpressionMammalianPromoterhuman Synapsin 1Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_NR1_NR2
Plasmid#176252PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and CRISPR array with spacers 1 and 2 targeting the Nitrate reductase gene of N. oceanica IMET1 separated by fullDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJEP308-pAAV-EFS-dSaCas9-VP64-Dio-pA
Plasmid#113685PurposeAn EFS driven inverted de-catalyzed SaCas9 fused to the transcription activator VP64. dSaCas9-VP64 is floxed to render the system cre-dependent.DepositorInsertinverted de-catalyzed SaCas9
UseAAV, CRISPR, Cre/Lox, and Synthetic BiologyTagsNLS and VP64Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT-Flag-NRBP1
Plasmid#48197PurposeExpressed flag-tagged NRBP1 (nuclear receptor binding protein 1)DepositorAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 myc-NL-GW
Plasmid#113446PurposeNanoLuc Gateway shuttle vector for N-terminal fusionsDepositorTypeEmpty backboneUseLuciferase; Gateway shuttle vectorTagscmyc-NanoLucExpressionMammalianPromoterCMVAvailable SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP305-pAAV-EFS-dSaCas9-KRAB-pA
Plasmid#113681PurposeA EFS driven de-catalyzed SaCas9 fused to KRAB domain for inhibition of transcription in targeted region.DepositorInsertde-catalyzed SaCas9
UseAAV and CRISPRTagsKRAB and NLSAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
JE301: pMVP (L5-L4) Tir1-P2A-AID
Plasmid#121722PurposepMVP L5-L4 entry plasmid, contains Tir1-P2A-AID for 4-component MultiSite Gateway Pro assembly. Allows expression of N-term Tir1 linked by P2A to AID domain fused to gene of interest.DepositorInsertosTir1-P2A-AID (open)
UseSynthetic Biology; Pmvp gateway entry plasmidTags9x myc (C-term on osTIR1)Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28b-MBP-TEV-PWWP_DNMT3A
Plasmid#186970PurposeBacterial expression of human DNMT3A PWWP domain (residues 278–427) with His-MBP tag and TEV protease cleavage site.DepositorInsertDNMT3A PWWP domain (DNMT3A Synthetic, Human)
TagsHis-MBPExpressionBacterialMutationPWWP domain (residues 278–427)PromoterT7Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE-BI GFP10-RHOB/RBD-GFP11
Plasmid#182231PurposeInducible coexpression of GFP10-RHOB and RBD-GFP11 domainDepositorInsertsUseLentiviralTagsGFP10 (split-GFP tripartite) and GFP11 (M4)PromoterTRE bidirectionalAvailable SinceApril 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 GW-NL-myc
Plasmid#113447PurposeNanoLuc Gateway shuttle vector for C-terminal fusionsDepositorTypeEmpty backboneUseLuciferase; Gateway shuttle vectorTagsNanoLuc-cmycExpressionMammalianPromoterCMVAvailable SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPGK-T7/2-CD44v6 (-cyt)
Plasmid#137817Purposeexpression of CD44 proteins in mammalian cellsDepositorInsertCD44v6 (-cyt) (CD44 Human)
TagsGFPExpressionMammalianMutationwithout cytoplasmic region, R296K (please see dep…PromoterPGKAvailable SinceJune 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
3xnls-cpmTq2-Calcium-lifetime-sensor
Plasmid#129626PurposeGenetically encoded calcium sensor (GECI) that reports with lifetime and intensity changesDepositorInsert3xnls-cpmTq2-Calcium-lifetime-sensor
Tags3xNLSExpressionMammalianPromoterCMVAvailable SinceJune 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Httex1-7Q
Plasmid#84347PurposeExpression of the human Huntingtin Exon1 protein containing 7Q in E.coliDepositorInsertHuntingtin Exon 1 (HTT Human)
TagsN-terminal His6-tagged intein SspExpressionBacterialPromoterT7Available SinceDec. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-p10-mCh (VE5626)
Plasmid#139772PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with mCherry cDNA under p10 to monitor infection.DepositorInsertmCherry fluorescent protein
PromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-VIM270-gCM
Plasmid#215868PurposeThis plasmid encodes luciferaase which has siRNA binding sites in 3'UTR for detecting the knockdown efficiency of siRNA.DepositorInserttarget site which is completely complementary to guide strand of siRNA for vimentin is inserted to 3'UTR of RLuc (VIM Human)
ExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Doc2A-GFP KI
Plasmid#131478PurposeEndogenous tagging of Doc2a: C-terminal (amino acid position: L402)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:dCas9:VPR:Tnos (GB1826)
Plasmid#160623PurposeTU for the constitutive expression of dCas9 fused to VPR (VP64-p65-Rta) activation domainsDepositorInsertP35S:dCas9:VPR-Tnos
ExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
Epac-S-H159
Plasmid#170347PurposemT2Del_EPACdDEPCD_tdBlackcp173Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_tdBlackcp173Ven(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJuly 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_alpha2: Pnos:ER:lexABD:GAL4AD:T35s-OplexA:mini35S:phi31:Tnos-Pnos:GR:LacIBD:Gal4AD:Tnos-OplacI:mini35S:RDF:Tnos (GB1679)
Plasmid#160619PurposeModule for estradiol-inducible expression of the PhiC31 integrase gene and dexamethasone -inducible expression of PhiC31 phage recombination directionality factor (RDF) gene.DepositorInsertERLexABDGal4AD / PhiC31 / GRLacIBDGal4AD / RDF
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJEP303-pAAV-CMV-dSaCas9-VP64-pA
Plasmid#113678PurposeA CMV driven de-catalyzed SaCas9 fused to VP64 domain for increased transcription in targeted regionDepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Synthetic BiologyTagsNLS and VP64Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BG505.SOSIP-QES.i03.c01-TM
Plasmid#111845PurposeMammalian expression plasmid for BG505 SOSIP.664 fused to a transmembrane tether; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 Env (BG505 SOSIP.664)
TagsCD5 leader sequence and TM helix from MHC class IExpressionMammalianMutationCodon-optimized synthetic gene; has SOSIP mutatio…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV7.1_3xFLAG-STK3
Plasmid#172990Purposeconstitutive expression of FLAG-tagged STK3DepositorAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FL-BCL2L1
Plasmid#78860PurposeDULIP positive control (prey) for assay establishmentDepositorInsertBCL2 like 1 (BCL2L1 Human)
UseExpression vectorTagsFirefly luciferase, V5-tagExpressionMammalianPromoterCMVAvailable SinceJuly 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEL033
Plasmid#137902PurposeSTU2.0 rAPOBEC1-SpyCas9(D10A) for plant genome base editingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceFeb. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
INS-GFP-CD19-EPT
Plasmid#210469PurposeDonor plasmid for knock-in GFP-CD19 into the human INS locusDepositorInsertINS homologous recombination arms with a GFP-CD19 and EF1alpha-drived puromycin-NLS-tdTomato selection cassette (INS Human)
UseCRISPRAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pST1374-D10A-GCN4
Plasmid#113025PurposeExpresses D10A-GCN4 in mammalian cellsDepositorAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-ultraID-LMNB1
Plasmid#207775PurposeDonor template for Blast-2A-ultraID insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-ultraID Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti myc-NL-GW
Plasmid#113454PurposeLentiviral NanoLuc Gateway shuttle vector for N-terminal fusionsDepositorTypeEmpty backboneUseLentiviral and LuciferaseTagscmyc-NanoLucExpressionMammalianPromoterhUbCAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pST1374-GCN4-dCas9
Plasmid#113023PurposeExpresses GCN4-dCas9 in mammalian cellsDepositorInsertGCN4-dCas9 (GCN4 S. pyogenes, Budding Yeast)
ExpressionMammalianMutationD10A, D839A, H840A, N863APromoterCMVAvailable SinceJuly 19, 2018AvailabilityAcademic Institutions and Nonprofits only