We narrowed to 11,061 results for: AGA
-
Plasmid#234990PurposeExpression of transmembrane region of Neuraminidase protein fused to an anti FLAG scFv antibody fragment for displaying on Viral like particles (VLPs) when cotranfected with GAG proteinDepositorInsertNA-3C-myc-scfvFLAG
ExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-miniDq-P2A-mCherry
Plasmid#204357PurposeAAV vector for miniDq expression under the control of human synapsin promoterDepositorInsertminiDq-P2A-mCherry
UseAAVTagsmCherryMutationThe third intracellular loop (ICL3) of hM3Dq was …PromoterhSynAvailable SinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmCherryC2-Gephyrin P1
Plasmid#68820PurposemCherry tagged Geph for mammalian expressionDepositorInsertGephyrin (Gphn Rat)
TagsmCherryExpressionMammalianMutationsilent mutations on internal EcoRI site. Gephyrin…PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pStreptagII 3C SMO
Plasmid#234995PurposeExpression of a Strep-tag II labeled on its N-terminus receptor, with the Smoothened (Smo) receptorDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEABR NA 3C FLAG SA
Plasmid#234987PurposeFor production of Extracellular Vesicles (EVs), with the transmembrane region of Neuraminidase protein fused to Streptavidin on the vesicles surfaceDepositorInsertEABR-NA
TagsHRV 3C site, FLAG, Strep-Tactin (SA)ExpressionMammalianMutationIn the Streptavidin coding sequence Glu44Val/Ser4…Available SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-HA-hRb-delta-CDK-T373D-S608D-S612D-puro
Plasmid#212675PurposeExpress tagged hRb phosphosite mutantDepositorInsertRb (RB1 Human)
UseLentiviralTagsHAMutation15 CDK phospho-sites are mutated to alanines, and…PromoterTREAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX335-NQL002-WAPL-sgRNA1
Plasmid#175550PurposeFor transient expression of spCas9-nickase and one sgRNA targeting the mouse WAPL locus. Use together with pX335-NQL003-WAPL-sgRNA2 targeting construct.DepositorInsertspCas9-nickase and sgRNA against mouse WAPL STOP Codon
UseMouse TargetingExpressionMammalianAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUDE710
Plasmid#103020Purposeexpression of a Cpf1 programming crRNA targeting ADE2 and HIS4 (crADE2-3 crHIS4-4.S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCR3-FLAG-Gephyrin GC
Plasmid#68818PurposeFlag tagged mammalian expression of GC domainDepositorAvailable SinceAug. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_1
Plasmid#155065PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR3-FLAG-Gephyrin G
Plasmid#68817PurposeGeph G domain expression in mamalian cellsDepositorAvailable SinceAug. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPB-EF1α-H2B-PA-mCherry-PGKneo
Plasmid#247340PurposeExpresses photoactivatable H2B-Cherry under EF1 promoter and can be randomly integrated by PiggyBac transposaseDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-IB-H2B-PA-mCherry
Plasmid#247339PurposeExpresses photoactivatable H2B-Cherry under CAG promoter and can be randomly integrated by PiggyBac transposaseDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-H2B-PAmCherry-FRT
Plasmid#247337PurposeExpresses photoactivatable H2B-Cherry under EF1 promoter and can be integrated into FRT siteDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR Gal4-UAS_3XFlag_4D5-5_CAR-mCherry_pGK_BFP
Plasmid#247572PurposeGAL4/UAS expression of a CAR against HER2 and mCherry with constitutive BFPDepositorInsertGAL4/UAS expression of a CAR against HER2 - mCherry and BFP constitutive
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mouse cGAS #2-gRNA-Cas9-Puro
Plasmid#186891PurposegRNA targeting mouse cGAS (with Cas9 insert)DepositorInsertCas9 (Cgas Mouse)
UseLentiviralAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK alfa mouse
Plasmid#224576PurposeNegative Control for downregulation of the expression of human DGK alfa in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-CAPRIN1-ts1
Plasmid#174229PurposeCAPRIN1 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(VENTX_5-5)-PGKpuroBFP-W
Plasmid#211993PurposeExpress gRNA against VENTX with puro and BFPDepositorInsertsgRNA targeting VENTX (VENTX Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFDPS #2
Plasmid#198760Purposeconditional knockdown of FDPSDepositorInsertshFDPS #2 (FDPS Human)
ExpressionMammalianAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon5
Plasmid#177763PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_gRNA_H19-DMR-1
Plasmid#159929PurposeSpecific gRNA against mouse H19-DMR cloned in the pX330 backbone (Addgene Number 42230). Deletion of H19-DMR in mouse ESC.DepositorInsertgRNA mouse H19-DMR (H19-icr Mouse)
UseCRISPR and Mouse TargetingExpressionMammalianPromoterU6, CBhAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_4
Plasmid#155076PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_4
Plasmid#155068PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
TLK2 gRNA (BRDN0001147939)
Plasmid#75617Purpose3rd generation lentiviral gRNA plasmid targeting human TLK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDKN1A (p21) targeting gRNA
Plasmid#215319PurposeExpresses gRNA targeting CDKN1A (p21) and pSpCas9(BB)-2A-GFP in mammalian cells from the px458 vector.DepositorInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-miniDq-mCherry-P2A-HA-KORD
Plasmid#204359PurposeAAV vector for coexpression of miniDq and KORD under the control of human synapsin promoterDepositorInsertminiDq-mCherry-P2A-HA-KORD
UseAAVTagsHA (for KORD) and mCherry (for miniDq)MutationFor miniDq, the third intracellular loop (ICL3) o…PromoterhSynAvailable SinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAcGFP1-N1-Dsup
Plasmid#90020PurposeTo express GFP-tagged Dsup in mammalian cells transientlyDepositorInsertDsup
TagsAcGFP1ExpressionMammalianPromoterCMVAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAcGFP1-N1-Dsup-C
Plasmid#90022PurposeTo express GFP-tagged C-terminal region of Dsup in mammalian cells transientlyDepositorInsertDsup
TagsAcGFP1ExpressionMammalianMutationC-terminal region alonePromoterCMVAvailable SinceMay 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgCTL
Plasmid#234771PurposeNon Targeting ControlDepositorInsertNon Targeting Control sgRNA
UseLentiviralAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mIDUA)
Plasmid#170123PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse IDUA mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Idua Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFPC2-Gephyrin P1
Plasmid#68815Purposeexpression of fluorescent tagged Geph in mammalian cellsDepositorInsertGephyrin (Gphn Rat)
TagsEGFPExpressionMammalianMutationsilent mutations on internal EcoRI site. Gephyri…PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g7-5)-PGKpuroBFP-W
Plasmid#211985PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pStreptagIIx2 Alfatag 3C InsR EABR
Plasmid#234996PurposeFor production of Extracellular Vesicles (EVs), with the Insulin Receptor Strep-tag II labeled on their surfaceDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCR3-FLAG-Gephyrin P1
Plasmid#68816PurposeFlag tagged Geph mammalian expressionDepositorInsertGephyrin (Gphn Rat)
Tags3xFLAGExpressionMammalianMutationsilent mutations on internal EcoRI site. Gephyrin…PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (GAPDH)
Plasmid#170120PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCJ207
Plasmid#162680PurposepET-21b(+) based plasmid for expression of the putative MHETase from Hydrogenophaga sp. PML113 (Genbank WP_083293388.1) with C-terminal His tag, codon optimized for expression in E. coli K12.DepositorInsertPutative MHETase from Hydrogenophaga sp. PML113 (Genbank WP_083293388.1) with signal peptide
TagsHisExpressionBacterialMutationcodon optimized for expression in E. coli K12PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC2-gephyrin S268A/270A
Plasmid#199608PurposeEncodes N-terminal eGFP-tagged P1-gephyrin S268/270A for expression in mammalian cells.DepositorAvailable SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCR3-FLAG-Gephyrin E
Plasmid#68819PurposeFlag tagged mammalian expression of E domainDepositorInsertGephyrin (Gphn Rat)
Tags3xFLAGExpressionMammalianMutationinternal EcoRI site has silent mutationPromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK alfa human
Plasmid#224578PurposeTo stably downregulate the expression of human DGK alfa in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(PDLIM1_Bru)-PGKpuroBFP-W
Plasmid#211979PurposeExpress gRNA against PDLIM1 with puro and BFPDepositorInsertsgRNA targeting PDLIM1 (PDLIM1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC2-gephyrin S268E/270E
Plasmid#199609PurposeEncodes N-terminal eGFP-tagged P1-gephyrin S268/270E for expression in mammalian cells.DepositorAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_2
Plasmid#155060PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and an intergenic site & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
Empty Bridge Control Zfp462-Klf4SE
Plasmid#127666PurposeEncodes for 4 gRNAs expressed from their individual hU6 promoters. Two gRNAs target the Zfp462 promoter while the other two target the Klf4 stretch enhancer.DepositorInsertgRNAs 129, 135, 115, 117
UseCRISPRExpressionMammalianPromoterhU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pStreptagII 3C EGFR EABR
Plasmid#234994PurposeFor production of Extracellular Vesicles (EVs), with Epithelial Growth Factor Receptor on their surface, Strep-tag II labeled on its N-terminusDepositorAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAcGFP1-N1-Dsup-deltaC
Plasmid#90023PurposeTo express GFP-tagged Dsup lacking C-terminal region in mammalian cells transientlyDepositorInsertDsup
TagsAcGFP1ExpressionMammalianMutationDeletion of C-terminal regionPromoterCMVAvailable SinceAug. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHA StreptagII 3C NIS EABR
Plasmid#234988PurposeFor production of Extracellular Vesicles (EVs), with a Strep-tag II labeled Sodium-iodide symporter (NIS), and an HA epitope at its N-terminus on their surfaceDepositorAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only