We narrowed to 6,517 results for: itch
-
Plasmid#183927PurposeOptogenetic PHR domain coupled to GFP and VP16 activation domain; binds to CIBN upon blue light exposureDepositorUseTagsExpressionMammalianMutationnonePromoterCMVAvailable sinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsUseTagsExpressionBacterialMutationPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
PvLEA4_repeats_k3_26_mCh-SspB (pBS1075)
Plasmid#185299PurposeMammalian expression of sleeping chironomid protein PvLEA4_repeats_k3_26 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation.DepositorInsertpvLEA22mer_shuffle_3
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
DHN_VrDHN1a_mCh-SspB (pBS1074)
Plasmid#185298PurposeMammalian expression of riverbank grape plant protein DHN_VrDHN1a attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation.DepositorInsertPvLEA4_repeats_k3_26
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_D125I_47-300_mCh-SspB (pBS1071)
Plasmid#185294PurposeFor the mammalian expression of the human protein ApoE3_D125I_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3_D125I_47-300
UseTagsExpressionMammalianMutationD125IPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_D125I_mCh-SspB (pBS1145)
Plasmid#185327PurposeFor the mammalian expression of the human protein ApoE3_D125I attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3_D125I
UseTagsExpressionMammalianMutationD125IPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE4_mCh-SspB (pBS1143)
Plasmid#185325PurposeFor the mammalian expression of the human protein ApoE4 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE4
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_mutant_3_mCh-SspB (pBS1080)
Plasmid#185303PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_3 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertpvLEA22mer_mutant_3
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PvLEA4_repeats_k5_1_mCh-SspB (pBS1079)
Plasmid#185302PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k5_1 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertPvLEA4_repeats_k5_1
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_mutant_10_mCh-SspB (pBS1078)
Plasmid#185301PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_10 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertpvLEA22mer_mutant_10
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAHS2_PARRC_98-130_mCh-SspB (pBS1077)
Plasmid#185300PurposeFor the mammalian expression of the tardigrade protein CAHS2_PARRC_98-130 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertCAHS2_PARRC_98-130
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
DSUP_RAMVA_1-208_mCh-SspB (pBS1073)
Plasmid#185296PurposeFor the mammalian expression of the tardigrade protein DSUP_RAMVA_1-208 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertDSUP_RAMVA_1-208
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
DHR93_Nccapped_mCh-SspB (pBS1072)
Plasmid#185295PurposeFor the mammalian expression of the synthetic protein DHR93_Nccapped attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertDHR93_Nccapped
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_47-300_mCh-SspB (pBS1070)
Plasmid#185293PurposeFor the mammalian expression of the human protein ApoE3_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3_47-300
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE4_47-300_mCh-SspB (pBS1069)
Plasmid#185292PurposeFor the mammalian expression of the human protein ApoE4_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE4_47-300
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE2_47-300_mCh-SspB (pBS1068)
Plasmid#185291PurposeFor the mammalian expression of the human protein ApoE2_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE2_47-300
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLPS2-CAHS2_PARRC::SspB (pBS1043)
Plasmid#185290PurposeFor the mammalian expression of the tardigrade protein CAHS2_PARRC attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertCAHS2_PARRC
UseTagsFLAGExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLPS1-FUSN:SspB (pBS1041)
Plasmid#185288PurposeFor the mammalian expression of the human protein FUSN attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertFUSN
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-DFDF-KFKF_C
Plasmid#146038PurposeInsect Expression of DmTral-DFDF-KFKFDepositorInsertDmTral-DFDF-KFKF (tral Fly)
UseTagsExpressionInsectMutationthree silent mutations A198C, A387G, A1437G and 4…PromoterAvailable sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5-FRT-TO-KIF1A(1-365)-VVDfast-mVenus-SSPB(micro)_P2A_iLID-mCherry-RAB11
Plasmid#174646PurposeOptogenetic coupling of RAB11 to opto-kinesin to induce anterograde transport of recycling endosomes. Compatible with Flp-in TREX system.DepositorInsertKIF1A(1-365)-VVDfast-mVenus-SSPB(micro)-P2A-iLID-mCherry-RAB11
UseTagsExpressionMammalianMutationmmKIF1A(aa1-365): Pro202Ala; mVenus: Met1Del, Thr…PromoterCMV (with TetOn)Available sinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pB80-KIF1A(1-365)-mVenus-SSPB(micro)
Plasmid#174635PurposeNon-processive monomeric KIF1A for optogenetic heterodimerization to iLID via SSPB(micro)DepositorInsertKIF1A(1-365)-mVenus-SSPB(micro) (Kif1a Mouse, Synthetic)
UseTagsmVenus-SSPB(micro)ExpressionMammalianMutationmmKIF1A(aa1-365): Pro202Ala; mVenus: Met1Del, Thr…PromoterChicken beta-actinAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pB80-KIF1A(1-383)-GFP-SSPB(micro)
Plasmid#174627PurposeConstitutively active KIF1A for optogenetic heterodimerization to iLID via SSPB(micro)DepositorInsertKIF1A(1-383)-GFP-SSPB(micro) (Kif1a Mouse, Synthetic)
UseTagsGFP-SSPB(micro)ExpressionMammalianMutationmmKIF1A(aa1-383): Pro202Ala; EGFP: Met1Del; SSPB:…PromoterChicken beta-actinAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLuc-OptoJNKi
Plasmid#89744PurposeExpression of light-regulated JNK inhibitor, firefly luciferase-fused, wild-type photosensor, inhibitor JIP11DepositorInsertOptoJNKi
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationPromoterCMVAvailable sinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSR13
Plasmid#69155Purposeread-outloxN mCherry to GFP switch, with swsn-1 promoter, gene (partially cDNA) and UTR, for integration on on ttTi5605, Mos Chr IIDepositorInsertsUseCre/Lox; MossciTagsExpressionWormMutationcodon-optimzed index 1.0, codon-optimzed index 1.…Promoterrps-27 and swsn-1Available sinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-iFlpV
Plasmid#140137Purposecan be used to generate AAV virus that will express light-inducible site-specific iFlpV recombinaseDepositorHas ServiceAAV PHP.eB and AAV1InsertiFlpV
UseAAVTagsExpressionMutationPromoterEF1aAvailable sinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR-BRD4ΔN-mCherry-sspB
Plasmid#121968PurposeExpresses fusion of disordered protein BRD4(462-1362), fluorescent protein mCherry, and sspB which upon light activation binds to iLID.DepositorInsertBRD4 (BRD4 Human)
UseLentiviralTagsmCherry-sspBExpressionMammalianMutationDeleted amino acids 1-461PromoterSFFVAvailable sinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-OptoSTIM1
Plasmid#70159PurposeMammalian expression plasmid of OptoSTIM1 (optogenetically-activated STIM1 protein)DepositorInsertOptoSTIM1 (STIM1 Human, Mustard Weed)
UseTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceNov. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONRp5-p2 SspB-mCherry-CShroom3
Plasmid#170977PurposeC-terminal component of OptoShroom3 optogenetic tool. Translocates to apical junctions to induce constriction upon blue light illumination if coexpressed with GFP-NShroom3-iLID. pDONRp5-p2 plasmid.DepositorInsertCShroom3 (Shroom3 Mouse)
UseGateway cloningTagsSspB and mCherryExpressionMutationIsoform X2, deleted aminoacids 1 - 1388PromoterAvailable sinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDY1623 NOLC1 sgRNA 2
Plasmid#234834PurposesgRNA 2 for NOLC1 STITCHR insertionDepositorInsertNOLC1 sgRNA (NOLC1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-mNeon-ACTB
Plasmid#207751PurposeDonor template for Blast-2A-mNeon insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Blast-mNeon Cassette (ACTB Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSecUAG-Evol2
Plasmid#163148PurposeExpresses machinery necessary for selenocysteine incorporation at UAG codonsDepositorInsertsallo-tRNA UTu2D
thioredoxin
Selenophosphate synthase
Selenocysteine synthase
Cysteine desulfurase
UseTagsExpressionBacterialMutationCysteine 32 switched to Selenocysteine (UAG), Cys…PromoterEM7, araBAD, native As SelD promoter, and native …Available sinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDY1622 NOLC1 sgRNA 1
Plasmid#234833PurposesgRNA 1 for NOLC1 STITCHR insertionDepositorInsertNOLC1 sgRNA (NOLC1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-GOLGA2
Plasmid#227325PurposeDonor template for mStayGold insertion into the N-terminus of the GOLGA2 locus. For Golgi visualization. To be co-transfected with sgRNA plasmid px330-PITCh-GOLGA2 (Addgene #207791)DepositorInsertGOLGA2 Homology Arms flanking a mStayGold Tag (GOLGA2 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Negative Control Binder
Plasmid#179140PurposeBinder: SspB that carries two point mutations reducing homodimerization(Y11K/A15E, residue numbering from pdb: 1ou9) and an additionional A70Q mutation greatly reduces affinity for SsrA peptideDepositorInsertSspB
UseTagsFLAG and mCherryExpressionMammalianMutationY11K/A15E, residue numbering from pdb: 1ou9. Addi…PromoterAvailable sinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
CIBN-GFP-Sec61B
Plasmid#104177PurposeExpresses fusion of CIB1 (1-170) with GFP and Sec61BDepositorUseTagsExpressionMammalianMutationPromoterCMVAvailable sinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
LAMP-mCherry-CRY2
Plasmid#102249PurposeExpresses fusion of CRY2PHR with mCherry and LAMP1 (1-415)DepositorUseTagsExpressionMammalianMutationPromoterCMVAvailable sinceNov. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-LMNB1
Plasmid#227329PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the LMNB1 locus. For nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 (Addgene #207770)DepositorInsertLMNB1 Homology Arms flanking a Puro-2A-mStayGold (LMNB1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-SspB-HaloTag-p63DH
Plasmid#176129PurposeHeterodimerization with iLID, RhoA activationDepositorInsertRHOGEF p63 (ARHGEF25 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTriEx-mCerulean-PA-Rac1
Plasmid#22030PurposeExpression of photoactivatable Rac1DepositorInsertPA-Rac1 (RAC1 Human, Avena sativa (oat))
UseTags6X His and mCeruleanExpressionBacterial, Insect, and Mamm…MutationRac1 starts at I4 and contains mutations Q61L, E9…PromoterCMV, p10Available sinceSept. 29, 2009AvailabilityAcademic Institutions and Nonprofits only -
pTriEx-mCherry-PA-Rac1-C450A
Plasmid#22028PurposeExpression of Rac1 fused with light-insensitive LOV2 (C450A mutation)DepositorInsertPA-Rac1-C450A (RAC1 Human, Avena sativa (oat))
UseTags6xHis and mCherryExpressionBacterial, Insect, and Mamm…MutationLOV(Leu404-Leu546, C450A). Rac1 starts at Ile4 an…PromoterCMV, p10Available sinceSept. 29, 2009AvailabilityAcademic Institutions and Nonprofits only