We narrowed to 11,061 results for: AGA
-
Plasmid#90019PurposeTo establish stable line expressing Dsup in constitutive mannerDepositorInsertDsup
ExpressionMammalianPromoterCAGAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ADAR2-2a-Fezf2 sesRNA-2a-tTA2-WPRE
Plasmid#239027PurposeExpression of ADAR2, sesRNA in mammalian cells with hSyn promoter, with tTA2 as efRNA and ADAR2 overexpression.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with interspersed loops (GAPDH)
Plasmid#180183PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops (GAPDH Human)
UseAAVExpressionMammalianPromoterHuman U6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with 8 bp bulge loops (GAPDH)
Plasmid#170121PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA with 8bp bulge loops (GAPDH Human)
UseAAVExpressionMammalianPromoterHuman U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S293A
Plasmid#115197PurposeLentiviral transduction and expression of PDHA2S293A into any mammalian cellDepositorAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-EF1α-Luc-C20orf24-3’UTR-WT
Plasmid#128551PurposeLentiviral constitutive expression of Firefly luciferase under control of WT 3'UTR of human C20orf24.DepositorInsertFirefly luciferase
UseLentiviral and LuciferaseExpressionMammalianPromoterEF1aAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
LADL Bridge + Target Zfp462-Klf4SE
Plasmid#127668PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter; 2 gRNAs targeting the Zfp462 promoter and 2 gRNAs targeting the Klf4 SE expressed from their individual hU6 promotersDepositorInsertCRY2-HA-2A-mCherry and gRNAs 129, 135, 115 and 117
UseCRISPRTagsHAExpressionMammalianPromoterEF1a and hU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
CDK11B gRNA (BRDN0001146011)
Plasmid#77065Purpose3rd generation lentiviral gRNA plasmid targeting human CDK11BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ETS2_5-5)-PGKpuroBFP-W
Plasmid#211959PurposeExpress gRNA against ETS2 with puro and BFPDepositorInsertsgRNA targeting ETS2 (ETS2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(FOXH1_5-4)-PGKpuroBFP-W
Plasmid#211963PurposeExpress gRNA against FOXH1 with puro and BFPDepositorInsertsgRNA targeting FOXH1 (FOXH1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ETS2_5-2)-PGKpuroBFP-W
Plasmid#211958PurposeExpress gRNA against ETS2 with puro and BFPDepositorInsertsgRNA targeting ETS2 (ETS2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-PARK7H126A
Plasmid#115180PurposeGateway cloning of PARK7H126A into any destination vectorDepositorInsertPARK7H126A (PARK7 Human)
UseGateway cloning into appropriate destination vect…Mutationp.H126AAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-PARK7E163K
Plasmid#115181PurposeGateway cloning of PARK7E163K into any destination vectorDepositorInsertPARK7E163K (PARK7 Human)
UseGateway cloning into appropriate destination vect…Mutationp.E163KAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2
Plasmid#115192PurposeLentiviral transduction and expression of PDHA2 into any mammalian cellDepositorAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291A
Plasmid#115196PurposeLentiviral transduction and expression of PDHA2S291A into any mammalian cellDepositorAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291A/S293A
Plasmid#115198PurposeLentiviral transduction and expression of PDHA2S291A/S293A into any mammalian cellDepositorAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-PARK7V51G
Plasmid#115178PurposeGateway cloning of PARK7V51G into any destination vectorDepositorInsertPARK7V51G (PARK7 Human)
UseGateway cloning into appropriate destination vect…Mutationp.V51GAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-PARK7C53A
Plasmid#115179PurposeGateway cloning of PARK7C53G into any destination vectorDepositorInsertPARK7C53A (PARK7 Human)
UseGateway cloning into appropriate destination vect…Mutationp.C53AAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-EF1α-Luc-C20orf24-3’UTR-VAR
Plasmid#128507PurposeLentiviral constitutive expression of Firefly luciferase under control of 3'UTR of human C20orf24 with variant from COX deficiency patient.DepositorInsertFirefly luciferase
UseLentiviral and LuciferaseExpressionMammalianAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shDnd1-No4
Plasmid#70065PurposeTRC lentiviral vector for shRNA against mouse Dnd1 #4DepositorAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF-FH-TAZ S89A-ires-blast
Plasmid#52084PurposeLentiviral expression vector for TAZ S89A mutant with N-terminal FLAG and His tagsDepositorInsertTAZ S89A (WWTR1 Human)
UseLentiviralTagsFLAG and HisExpressionMammalianMutationS89APromoterEF1aAvailable SinceApril 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF-FH-TAZ-ires-blast
Plasmid#52083PurposeLentiviral expression vector for TAZ with N-terminal FLAG and His tagsDepositorAvailable SinceApril 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHA TST 3C SMO EABR
Plasmid#234989PurposeFor production of Extracellular Vesicles (EVs), with the receptor Smoothened (Smo), Twin-Strep-tag (TST), and an HA tag at its N-terminus on their surfaceDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX458-sgEIF4EBP1
Plasmid#128097PurposeCRISPR gRNA against human EIF4EBP1 (4EBP1) with Cas9 from S. pyogenes and 2A-EGFPDepositorInsertCRISPR sgRNA against human 4EBP1 (EIF4EBP1 Human)
UseCRISPRExpressionMammalianPromoterhU6Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
8024 GFP_Kras_G12C_2A_puro
Plasmid#64373PurposeThis a retroviral expression plasmid expressing GFP tagged G12C mutant Kras 2A oncogene along with puro resistance geneDepositorAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
8027_GFP-KrasG12C_2B_puro
Plasmid#64372PurposeThis a retroviral expression plasmid expressing GFP tagged G12C mutant Kras 2B oncogene along with puro resistance geneDepositorAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
8798 GFP-KrasG12C_2B_hygro
Plasmid#64376PurposeThis a retroviral expression plasmid expressing GFP tagged G12C mutant Kras 2B oncogene along with hygro resistance geneDepositorAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
8047_GFP-Kras2B_ires_puro
Plasmid#64371PurposeThis a retroviral expression plasmid expressing GFP tagged wild type Kras 2B oncogene along with puro resistance geneDepositorAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
shERK2b-mlpx-puro
Plasmid#65230Purposeencodes a shRNA against ERK2DepositorAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
shERK2a-mlpx-puro
Plasmid#65229Purposeencodes a shRNA against ERK2DepositorInsertshRNA against ERK2 (MAPK1 Human)
ExpressionMammalianAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCJ211
Plasmid#162684PurposepET-21b(+) based plasmid for expression of the putative MHETase from Hydrogenophaga sp. PML113 (Genbank WP_083293388.1) with deletion of the predicted signal peptide (Lys2:Gly19), with C-terminal His tag, codon optimized for expression in E. coli K12.DepositorInsertPutative MHETase from Hydrogenophaga sp. PML113 (Genbank WP_083293388.1) without 19 residue signal peptide
TagsHisExpressionBacterialMutationdeltaK2:G19; codon optimized for expression in E.…PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-CR-NENF-C-TAP
Plasmid#128511PurposeLentiviral constitutive expression of CRISPR-resistant NENF with c-terminal FLAG and HA tag.DepositorInsertNENF (NENF Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationSynonymous silent mutations to F81, Y82, G83 and …PromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
shERK2b-mlpx-neo
Plasmid#65231Purposeencodes a shRNA against ERK2DepositorAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7WT-VA
Plasmid#115182PurposeLentiviral transduction and expression of PARK7WT into any mammalian cellDepositorInsertPARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-C20orf24- C20orf24-3’UTR-WT
Plasmid#128508PurposeLentiviral constitutive expression of C20orf24 under control of its native WT 3'UTR of human C20orf24.DepositorAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ETV4_5-2)-PGKpuroBFP-W
Plasmid#211961PurposeExpress gRNA against ETV4 with puro and BFPDepositorInsertsgRNA targeting ETV4 (ETV4 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmirGLO-3'UTR mouse Il13 mutDRACH
Plasmid#207130PurposeLuciferase vector containing 3'UTR for mouse Il13 with mutated DRACH sitesDepositorInsertInterleukin 13 (Il13) 3'UTR (Il13 Mouse)
UseLuciferaseExpressionMammalianMutationTGAGGAGAGACCATCCCTGGGCATCTCAGCTGTGGACTCATTTTCCTTT…Available SinceDec. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7V51G-VA
Plasmid#115183PurposeLentiviral transduction and expression of PARK7V51G into any mammalian cellDepositorInsertPARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.V51GPromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7C53A-VA
Plasmid#115184PurposeLentiviral transduction and expression of PARK7C53A into any mammalian cellDepositorInsertPARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.C53APromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7H126A-VA
Plasmid#115185PurposeLentiviral transduction and expression of PARK7H126A into any mammalian cellDepositorInsertPARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.H126APromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7E163K-VA
Plasmid#115186PurposeLentiviral transduction and expression of PARK7E163K into any mammalian cellDepositorInsertPARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.E163KPromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-C20orf24- C20orf24-3’UTR-VAR
Plasmid#128509PurposeLentiviral constitutive expression of C20orf24 under control of its native 3'UTR of human C20orf24 with variant from COX deficiency patient.DepositorAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pattB-LSL-AAVR-F2A-spCas9
Plasmid#202459PurposeThe plasmid backbone used to generate the recombination template to generate the SELECTIV mice through Integrase Mediated Transgenesis. Allows for Cre-dependent expression of AAVR and Cas9.DepositorInsertAAVR (AU040320 Mouse)
UseCRISPR, Cre/Lox, and Mouse TargetingTagsmCherry fusionExpressionMammalianPromoterCAGAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EmGFP-LATS2/1 KD
Plasmid#52085PurposeLentiviral RNAi vector for knockdown of LATS2 and LATS1. Co-expresses EmGFP as reporterDepositorAvailable SinceMay 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-CR-PINK1-C-TAP
Plasmid#128510PurposeLentiviral constitutive expression of CRISPR-resistant PINK1 with c-terminal FLAG and HA tag.DepositorInsertPTEN induced kinase 1 (PINK1 Human)
UseLentiviralTagsFLAG and HA tagsExpressionMammalianMutationSynonymous silent mutation in Q5 to render sgRNA …PromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293A
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only