We narrowed to 13,316 results for: ache
-
Plasmid#207751PurposeDonor template for Blast-2A-mNeon insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Blast-mNeon Cassette (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-VenusYFP-3AT
Plasmid#71269PurposeEntry clone containing Venus. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertVenusYFP
UseGatewayTags4xGly linker and T3A pea Pisum sativum ribulose-1…Available SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-SpCas9_gRNA(RHO-P23H)-CMV-mTagBFP2_(RAS3613)
Plasmid#228252PurposepU6 (human U6) expression of SpCas9 sgRNA targeting RHO P23H mutation and pCMV expression of mTagBFP2DepositorInsertSpCas9 P23H sgRNA, mTagBFP2
ExpressionMammalianMutationn/aPromoterCMV and U6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAB(EXPR-PYL-HDAC3-NEO)
Plasmid#114394PurposeFor PYL-HDAC3 expressionDepositorAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
EFS-FLAG-SpCas9-6xNLS(c-Myc)-P2A-Puro (pRG214)
Plasmid#221385PurposeLentiviral expression of SpCas9-6xNLS(c-Myc) with puromycin resistance geneDepositorInsertSpCas9
UseCRISPR and LentiviralTagsFLAGExpressionMammalianAvailable SinceJune 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-NMHC-IIA-S1916A
Plasmid#101040PurposeExpresses GFP-MYH9 construct (human myosin IIA) carrying mutation of serine 1916 to alanine, driven by CMV promoter. Thus inhibits PKC phosphorylation of the tail. Also carries S1915A mutation.DepositorInsertNon-muscle myosin IIA heavy chain (MYH9 Human)
TagsGFPExpressionMammalianMutationS1916A, S1917APromoterCMVAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV.CAG.SF-Venus-iGluSnFR.A184S
Plasmid#106201PurposeTight affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.A184S
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184SPromoterCAGAvailable SinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-mCherry-TEV
Plasmid#105779PurposeExpression of your protein of interest in fusion with red fluorescent protein at the N-terminus (cleavable by TEV), (PMID: 15558047). mCherry descends from the first truly monomeric red FP mRFP1.DepositorTypeEmpty backboneUseFlp-in competentTagsmCherry-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcsII-pb2-flag
Plasmid#86766PurposeC-terminal flag-tagged protein expression in mammalian cells, lentiviral vectorDepositorInsertproteasome beta subunit 2 (PSMB2 Human)
UseLentiviralTagsflagExpressionMammalianPromoterEF-1aAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapsin.SF-Venus-iGluSnFR.A184V
Plasmid#106178PurposeMedium affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.A184V
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184VPromoterhSynapsinAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pNL-CEF-CD79A-YFP
Plasmid#187004PurposeExpression of human CD79A as YFP fusion proteinDepositorAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nprot-HF_GC3opt
Plasmid#157732Purposemammalian expression of C-terminally His8-Flag tagged SARS-CoV-2 N protein under control of a tetracycline-inducible promoterDepositorInsertNprot-HF_GC3opt (N SARS-CoV-2)
TagsHis8-FlagExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available SinceAug. 10, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG-FLEX.SF-Venus-iGluSnFR.A184S
Plasmid#106189PurposeTight affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.A184S
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184SPromoterCAGAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-3xFLAG-LMNB1
Plasmid#207777PurposeDonor template for Blast-2A-3xFLAG insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-3xFLAG Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV.hSynapsin.SF-Venus-iGluSnFR.A184S
Plasmid#106177PurposeTight affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.A184S
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184SPromoterhSynapsinAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-ALDH1A3
Plasmid#189750PurposeThe construct was used to express recombinant ALDH1A3 in E.Coli. The purified protein was used for activity assay.DepositorAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLIB_GST-TEV-SRC (Y530F)
Plasmid#223743PurposeExpression of recombinant protein for purificationDepositorInsertSrc Kinase (SRC Human)
TagsGST-TEVExpressionInsectMutationY530F constitutively active mutantAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-CMV-mtagBFP2-2A-FLAG-cGAS E225A/D227A
Plasmid#102604PurposeLentivector to express Flag-tagged and catalytically-inactive cGAS and mTagBFPDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-CLTC
Plasmid#227314PurposeDonor template for mStayGold-2A-Puro insertion into the C-terminus of the CLTC locus. For clathrin heavy chain visualization. To be co-transfected with sgRNA px330-PITCh-CLTC (Addgene #227312)DepositorInsertCLTC Homology Arms flanking a mStayGold-2A-Puro Cassette (CLTC Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-PEX3
Plasmid#227304PurposeDonor template for mStayGold insertion into the C-terminus of the PEX3 locus. For peroxisome visualization. To be co-transfected with sgRNA plasmid px330-PITCh-PEX3 (Addgene #227303)DepositorInsertPEX3 Homology Arms flanking a mStayGold Tag (PEX3 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSUMO His6 SUMO SnRK2.6 (11-362)
Plasmid#177847PurposeBacterial Expression of SnRK2.6DepositorAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNL-CEF-CD79A-RFP
Plasmid#187003PurposeExpression of human CD79A as RFP fusion proteinDepositorAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG_GST-TEV-EGFP-ATG13
Plasmid#223797PurposeExpression of recombinant protein for purificationDepositorAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKK-BI16-TEV-mCherry
Plasmid#105800PurposeConcomitant expression of two proteins. One protein is expressed with mCherry fusion tag (at the C-terminus), cleavable by TEV protease; second tag introduced by user.DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-mCherryExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-mRuby3-TEV
Plasmid#105780PurposeExpression of your protein of interest in fusion with red fluorescent protein at the N-terminus (cleavable by TEV), (PMID: 26879144). mRuby3 is brighter than mCherry and has shifted ex and em spectra.DepositorTypeEmpty backboneUseFlp-in competentTagsmRuby3-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDEST40-mPTER
Plasmid#224864PurposeMammalian expression mouse PTER proteinDepositorAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET20b-mPTER
Plasmid#222189PurposeBacterial expression of mouse PTER proteinDepositorAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKK-TEV-mRuby3
Plasmid#105797PurposeExpression of your protein of interest in fusion with red fluorescent protein at the C-terminus (cleavable by TEV) (PMID: 26879144). mRuby3 is brighter than mCherry and has shifted ex and em spectra.DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-mRuby3ExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
hum alpha ENAC promoter a25-a23
Plasmid#83427Purposepromoter reporter construct to test 5' flanking sequencesDepositorInserthuman aENaC gene 5' flanking seq + 55 nt of the 5' UTR for exon 1A (SCNN1A Human)
UseLuciferaseTagsLuciferasePromoteralpha ENACAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
shBCL2L1 # 2
Plasmid#42552DepositorAvailable SinceMay 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
shBCL2L1 # 1
Plasmid#42551DepositorAvailable SinceMay 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-flex-iGABASnFR2(no bind)-WPRE
Plasmid#218882PurposeAAV-mediated expression of improved GABA sensor control (no change in fluorescence)DepositorInsertiGABASnFR2(no bind)
UseAAV and Cre/LoxExpressionMammalianMutationS99A F102G R168PPromoterCAGAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Hygro(+)-PSTCD-cGAS-delta DBD
Plasmid#102606PurposeMammalian expression of mutant cGAS with deletion of DNA binding domain fused to PSTCD tagDepositorInsertcGAS (CGAS Human)
ExpressionMammalianMutationdelta K173-I220 and delta H390-C405PromoterCMVAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A mKate2-hu_ncOGT K842M
Plasmid#154284PurposeEntry vector encoding mKate2-2xFLAG-OGT (O-GlcNAc Transferase; K842M variant, catalytic dead)DepositorInsertO-GlcNAc Transferase (OGT Human)
UseGateway entry vectorTags2x FLAG and mKate2MutationK842M mutation (Catalytic Inactive)Available SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAuroraA GFP-AURKA-GFP
Plasmid#157765PurposeExpression of AURKA fused to GFP at both ends in mammalian cells under AurkA promoterDepositorInsertAURKA (AURKA Human)
TagsGFPExpressionMammalianMutationpromoter CMV replaced by AurkA promoterPromoterAURKA minimalAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
MAC-CTSB
Plasmid#172413PurposeMAC-tagged gene expressionDepositorAvailable SinceNov. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKK-TEV-MBP
Plasmid#105787PurposeExpression of your protein of interest in fusion with MBP at the C-terminus (cleavable by TEV). The maltose binding protein tag allows convenient purification of proteins (PMID: 22442034, 19935684).DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-MBPExpressionMammalianAvailable SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-3xHA-LMNB1
Plasmid#207778PurposeDonor template for Blast-2A-3xHA insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-3xHA Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5-FRT-TO-Nsp13-HF_GC3opt
Plasmid#157716Purposemammalian expression of C-terminally His8-Flag tagged SARS-CoV-2 Nsp13 under control of a tetracycline-inducible promoterDepositorInsertNsp13-HF_GC3opt (ORF1ab SARS-CoV-2)
TagsHis8-FlagExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV.CAG.SF-Venus-iGluSnFR.A184V
Plasmid#106202PurposeMedium affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.A184V
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184VPromoterCAGAvailable SinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMIG-hNFATc2/C - AVITEV
Plasmid#74058Purposeretroviral expression plasmid for human NFATc2/C with C-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc2, isoform C (NFATC2 Human)
UseRetroviralTagsAVI-TEVExpressionMammalianMutationsilent mutation A1723C in the sequence of NM_1730…PromoterpMSCV-LTRsAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-OS
Plasmid#136576PurposeDox-inducible polycistronic lentiviral vector expressing mouse Oct4, Sox2DepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
LIC1B_Caspase-LOVN7C-7 C450A
Plasmid#104628Purposebacterial expression of light-activated caspase-3 with N7C-7 linker variation on C450A mutationDepositorInsertCaspase-3 (CASP3 Human)
TagsHis and LOV2ExpressionBacterialMutationC450A (dark-locked and light-insensitive mutation)PromoterT7Available SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-STU
Plasmid#138110PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized LbCas12a without promoter and terminatorDepositorInsertLbCas12a
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CLTC
Plasmid#227313PurposeDonor template for mStayGold insertion into the C-terminus of the CLTC locus. For clathrin heavy chain visualization. To be co-transfected with sgRNA px330-PITCh-CLTC (Addgene #227312)DepositorInsertCLTC Homology Arms flanking a mStayGold Tag (CLTC Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-GAL4-IL35-IRES-mCherry-PGK-BFP
Plasmid#223210PurposeLentiviral vector - mCherry reporter and IL35 for Gal4DBDVP64 synNotch receptors with a constitutive BFPDepositorAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-GAL4-PDL1-IRES-mCherry-PGK-BFP
Plasmid#223208PurposeLentiviral vector - mCherry reporter and PDL1 for Gal4DBDVP64 synNotch receptors with a constitutive BFPDepositorAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only