We narrowed to 39,944 results for: ANT
-
Plasmid#223152PurposeExpression of truncated HP1b with dSaCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 79-173PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
MAC-C Sars-CoV-2 S_L241-243del
Plasmid#194841PurposeSars-CoV-2 S_L241-243del in MAC-C destination vectorDepositorAvailable SinceMay 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
AGTR1-DuET
Plasmid#213183PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-Cx32D178Y-IRES-GCaMP6s
Plasmid#216796PurposeInducible bicistronic lentiviral plasmid for the simultaneous expression of the D178Y mutant form of Connexin 32 and cytosolic GCaMP6sDepositorAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pExp-His-zBasic-RBD-Avi
Plasmid#195000PurposeProduction of SARS-CoV2 receptor binding domain in E. coli with C-terminal Avi-tagDepositorAvailable SinceJan. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-DSep1-msfGFP
Plasmid#174494Purposebacterial expression of Drosophila Sep1 fused to monomeric superfolder GFPDepositorAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ287-RVR
Plasmid#138124PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized BsCas12a with N512R, K518V and N522R mutations, without promoterDepositorInsertBsCas12a RVR variant
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantMutationN512R, K518V and N522RAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ285-RVR
Plasmid#138121PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized Lb5Cas12a with N512R, K518V and N522R mutations, without promoterDepositorInsertLb5Cas12a RVR variant
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantMutationN512R, K518V and N522RAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 tRNA-gRNA E4-En-1 (GB2243)
Plasmid#160565PurposetRNA and scaffold for the assembly of GBoligomers for the position [4_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInserttRNA-gRNA position E4-En-1 (Multiplexing Edit)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA
Plasmid#182653PurposeEncodes codon-optimized AF mutant of M. mazei pyrrolysine (Pyl) tRNA synthetase fused to a nuclear export signal (NESPylRSAF),tRNACUAPyl & eRF1E55D used for amber codon suppression in mammalian cellsDepositorInsertscodon-optimized Y306A/Y384F (AF) double mutant of Methanosarcina mazei-derived pyrrolysine (Pyl) tRNA synthetase
PylT
mutant eukaryotic release factor 1
TagsHA tag and nuclear export signal (NES)ExpressionMammalianMutationE55D and Y306A/Y384F (AF) double mutant of Methan…PromoterCMV and U6Available SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN4-ires-puro
Plasmid#167828PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN4
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBK2044-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2
Plasmid#223164Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN5-ires-puro
Plasmid#167821PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN5
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
Venus1-WTSTAT3
Plasmid#123164PurposeExpresses wild type STAT3 fused to the 1-157 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus1 (aa 1-157) (STAT3 Human)
TagsVenus1 (aa 1-158) for bimolecular fluorescence co…ExpressionMammalianMutationnonePromoterpCMVAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-WTSTAT3
Plasmid#123165PurposeExpresses wild type STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
TagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationnoneAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus1-S727A-STAT3
Plasmid#123174PurposeExpresses S727A STAT3 fused to the 1-157 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus1 (aa 1-157) (STAT3 Human)
TagsVenus1 (aa 1-158) for bimolecular fluorescence co…ExpressionMammalianMutationS727A substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus1-Y705F-STAT3
Plasmid#123172PurposeExpresses Y705F STAT3 fused to the 1-157 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus1 (aa 1-157) (STAT3 Human)
TagsVenus1 (aa 1-158) for bimolecular fluorescence co…ExpressionMammalianMutationY705F substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus1-K685R-STAT3
Plasmid#123170PurposeExpresses K658R STAT3 fused to the 1-157 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus1 (aa 1-157) (STAT3 Human)
TagsVenus1 (aa 1-158) for bimolecular fluorescence co…ExpressionMammalianMutationK685R substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-Y705F-STAT3
Plasmid#123173PurposeExpresses Y705F STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
TagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationY705F substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-S727A-STAT3
Plasmid#123175PurposeExpresses S727A STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
TagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationS727A substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus1-K49R-STAT3
Plasmid#123166PurposeExpresses K49R STAT3 fused to the 1-157 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus1 (aa 1-157) (STAT3 Human)
TagsVenus1 (aa 1-158) for bimolecular fluorescence co…ExpressionMammalianMutationK49R substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-K49R-STAT3
Plasmid#123167PurposeExpresses K49R STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
TagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationK49R substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus1-K140R-STAT3
Plasmid#123168PurposeExpresses K140R STAT3 fused to the 1-157 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus1 (aa 1-157) (STAT3 Human)
TagsVenus1 (aa 1-158) for bimolecular fluorescence co…ExpressionMammalianMutationK140R substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-K140R-STAT3
Plasmid#123169PurposeExpresses K140R STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
TagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationK140R substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-K685R-STAT3
Plasmid#123171PurposeExpresses K695R STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
TagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationK685R substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ERBB2-V5/HIS
Plasmid#201103Purposeexpression of human ERBB2 receptor tyrosine kinase in mammalian cellsDepositorInserthuman ERBB2 receptor tyrosine kinase, full length, wildtype (ERBB2 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-YFP-KRAS4B
Plasmid#112718PurposeExpresses YFP-KRAS4B fusion protein used for FRET studies in eukaryotic cells.DepositorInsertYFP-KRAS4B (KRAS Human)
ExpressionMammalianAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3_CoV2_501V2
Plasmid#170449PurposeExpress SARS-CoV-2 501V2 (South Africa strain / beta strain) spike protein with an 18aa deletion on the C-terminal tail. Used for SARS2 501V2 pseudotyped virus production.DepositorInsertSARS-CoV-2 501V2 spike D18 (S SARS-CoV-2, 501V2 (B.1.351))
TagsNAExpressionMammalianMutationL18F, D80A, D215G, R246I, K417N, E484K, N501Y, D6…PromoterCMVAvailable SinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTR01F/hFGFR2c-V5
Plasmid#236013Purposefor PiggyBac mediated integration and stable expression of hFGFR2c proteinDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-P301L Tau
Plasmid#176267PurposeThis AAV plasmid vector expresses human 2N4R microtubule-associated protein tau with P301L mutation.DepositorAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.3_CoV2_B.1.1.7
Plasmid#170451PurposeExpress SARS-CoV-2 B.1.1.7 (UK strain / alpha strain) spike protein with an 18aa deletion on the C-terminal tail. Used for SARS2 (UK strain) pseudotyped virus production.DepositorInsertSARS-CoV-2 501V2 spike D18 (S SARS-CoV-2, UK strain (B.1.1.7))
TagsNAExpressionMammalianMutationHY69-70del, Y144del, N501Y, A570D, D614G, P681H, …PromoterCMVAvailable SinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-SpCas9-HF1
Plasmid#201952PurposeMammalian expression plasmid of high-fidelity SpCas9 variant SpCas9-HF1 with T2A-EGFP and cloning backbone for sgRNADepositorInsertMammalian expression plasmid of high-fidelity SpCas9 variant SpCas9-HF1 with T2A-EGFP and cloning backbone for sgRNA
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianPromoterCbhAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPER-DuET
Plasmid#213256PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3_CoV2_P1
Plasmid#170450PurposeExpress SARS-CoV-2 P.1 (Brazil / gamma) strain spike protein with an 18aa deletion on the C-terminal tail. Used for SARS2 P.1 pseudotyped virus production.DepositorInsertSARS-CoV-2 P.1 spike D18 (S SARS-CoV-2, P.1 strain)
TagsNAExpressionMammalianMutationL18F, T20N, P26S, D138Y, R190S, K417T, E484K, N50…PromoterCMVAvailable SinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTR01F/hFGFR2b-V5
Plasmid#236014Purposefor PiggyBac mediated integration and stable expression of hFGFR2b proteinDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN5-ires-blast
Plasmid#167822PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN5
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FRT-Rev-TdTomato
Plasmid#191203PurposeFlpO dependent TdTomato expressionDepositorInsertTdTomato
UseAAVExpressionMammalianPromoterCAGAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FRT-Rev-3xGFP
Plasmid#191204PurposeFlpO dependent GFP expressionDepositorInsert3X GFP
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Flex-FlpO
Plasmid#191202PurposeCre dependent FlpO expressionDepositorInsertFlpO
UseAAVExpressionMammalianPromoterhSynAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
LgBiT-hACE2
Plasmid#173431Purposeprotein expression plasmid of LgBiT-hACE2-IgG1 FcDepositorAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN5(TA)-ires-puro
Plasmid#167823Purposecontrol sensor for EKAREN5DepositorInsertEKAREN5(TA)
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s(alpha3beta5/G226A/A366S)
Plasmid#55797PurposeThis highly effective dominant negative G protein alpha-s mutant contains, in addition to the mutations in alpha-s(alpha3beta5/G226A), the A366S mutation, which increases GDP release.DepositorInsertalpha-s (alpha3beta5/G226A/A366S) (Gnas Rat)
Tagsinternal EE epitope (residues 189-194 in alpha-s …ExpressionMammalianMutationN271K, K274D, R280K, T284D, I285T, G226A, A366S i…PromoterCMVAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti_EF1a_Flag_TP53_R248W+P278A
Plasmid#183115PurposeExpresses flag-tagged p53 with both R248W and P278A mutations in mammalian cellsDepositorInsertTP53 (TP53 Human)
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationchanged proline 278 to alanine and arginine 248 t…PromoterEF1aAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPB-tetO(hCMV1)-HA-Tet1(201R2)-IV
Plasmid#102421PurposeInducible expression of siRNA resistant mouse Tet1-201 (Ensembl transcript ENSMUST00000050826.13) with HA-tag and IRES-Venus in piggyBac (PB) transposon vectorDepositorInsertTet1 (Tet1 Mouse)
TagsHAExpressionMammalianMutationModified at the Dharmacon SMARTpool siRNA #2 targ…PromoterTetO-CMVAvailable SinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
CXCR4-DuET
Plasmid#213221PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-PE SpRY
Plasmid#179082PurposeNOTE: An improved version of this plasmid is now available. See Addgene plasmid #235998. All-in-one prime editor piggyBac transposon, SpRY variantDepositorInsertSpCas9 SpRY_H480A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsSV40 NLSExpressionMammalianMutationA61R, L1111R, D1135L, S1136W, G1218K, E1219Q, N13…PromoterCAGAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MKK1K97A
Plasmid#107974Purposeexpression of a dominant negative MAP Kinase KinaseDepositorInsertMKK1 K97A (MAP2K1 Human)
ExpressionMammalianMutationdominant negative; see Depositor Comments belowPromoterCMVAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLED.NPL
Plasmid#193014PurposeNeuron-specific reporter (CBh promoter, Pls3 exon, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only