-
Plasmid#202463PurposeExpresses GFPuv with T7 inductionDepositorInsertGFPuv
UseTagsExpressionBacterialMutationPromoterT7Available sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-RELA-PGK-EGFP
Plasmid#228051PurposeHomologous donor template for RELA knockout expressing EGFPDepositorInsertEGFP
UseCRISPRTagsExpressionMammalianMutationPromoterPGKAvailable sinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-RELB-PGK-EGFP
Plasmid#228052PurposeHomologous donor template for RELB knockout expressing EGFPDepositorInsertEGFP
UseCRISPRTagsExpressionMammalianMutationPromoterPGKAvailable sinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-RELC-PGK-EGFP
Plasmid#228053PurposeHomologous donor template for RELC knockout expressing EGFPDepositorInsertEGFP
UseCRISPRTagsExpressionMammalianMutationPromoterPGKAvailable sinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-RELA-PGK-tdTomato
Plasmid#228054PurposeHomologous donor template for RELA knockout expressing tdTomatoDepositorInserttdTomato
UseCRISPRTagsExpressionMammalianMutationPromoterPGKAvailable sinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-RELC-PGK-tdTomato
Plasmid#228056PurposeHomologous donor template for RELC knockout expressing tdTomatoDepositorInserttdTomato
UseCRISPRTagsExpressionMammalianMutationPromoterPGKAvailable sinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-EGFP-nonstop
Plasmid#226406PurposeExpresses EGFP without a stop codon that produces a GFP-tagged readthrough RQC substrate.DepositorInsertEGFP without stop codon
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X10
Plasmid#226552PurposeBacterial expression of N-terminally 6His tagged A1-LCD X10DepositorInsertA1-LCD swap X10
UseTags6xHisExpressionBacterialMutationPromoterT7Available sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X9
Plasmid#226551PurposeBacterial expression of N-terminally 6His tagged A1-LCD X9DepositorInsertA1-LCD swap X9
UseTags6xHisExpressionBacterialMutationPromoterT7Available sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X8
Plasmid#226550PurposeBacterial expression of N-terminally 6His tagged A1-LCD X8DepositorInsertA1-LCD swap X8
UseTags6xHisExpressionBacterialMutationPromoterT7Available sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X6
Plasmid#226548PurposeBacterial expression of N-terminally 6His tagged A1-LCD X6DepositorInsertA1-LCD swap X6
UseTags6xHisExpressionBacterialMutationPromoterT7Available sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X2
Plasmid#226544PurposeBacterial expression of N-terminally 6His tagged A1-LCD X2DepositorInsertA1-LCD swap X2
UseTags6xHisExpressionBacterialMutationPromoterT7Available sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-L1374
Plasmid#226275PurposePlasmid expressing the SEC18 allele from L-1374, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-S288C
Plasmid#226274PurposePlasmid expressing the SEC18 allele from S288C, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-NCYC110
Plasmid#226277PurposePlasmid expressing the SEC18 allele from NCYC110, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-UWOPS872421
Plasmid#226276PurposePlasmid expressing the SEC18 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-S288C
Plasmid#226266PurposePlasmid expressing the SCT1 allele from S288C, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-L1374
Plasmid#226267PurposePlasmid expressing the SCT1 allele from L-1374, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorInsertLUG1 gRNA (YLR352W Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorInsertLEU2 gRNA (LEU2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-NCYC110
Plasmid#226269PurposePlasmid expressing the SCT1 allele from NCYC110, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-UWOPS872421
Plasmid#226268PurposePlasmid expressing the SCT1 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB67
Plasmid#226316PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with K to A CsoS2 MR1-6
UseTagsExpressionBacterialMutationK261A, K320A, K380A, K436A, K495A, K546APromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB68
Plasmid#226315PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with Y to A CsoS2 MR1-7
UseTagsExpressionBacterialMutationY300A, Y359A, Y420A, Y475A, Y534A, Y585A, Y644APromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB74
Plasmid#226314PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with Y to A CsoS2 MR1-5
UseTagsExpressionBacterialMutationY300A, Y359A, Y420A, Y475A, Y534APromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB73
Plasmid#226313PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with Y to A CsoS2 MR1-3
UseTagsExpressionBacterialMutationY300A, Y359A, Y420APromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB51
Plasmid#226308PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with V(T/S)G to AAA CsoS2 MR1
UseTagsExpressionBacterialMutationVTG273-275AAA, VTG284-286AAA, VTG295-297AAAPromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB48
Plasmid#226307PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-6
UseTagsExpressionBacterialMutationC292S, C310S, C351S, C369S, C467S, C485S, C526S, …PromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB47
Plasmid#226306PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-5
UseTagsExpressionBacterialMutationC292S, C310S, C351S, C369S, C467S, C485S, C526S, …PromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB46
Plasmid#226305PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-4
UseTagsExpressionBacterialMutationC292S, C310S, C351S, C369S, C467S, C485SPromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB45
Plasmid#226304PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-2
UseTagsExpressionBacterialMutationC292S, C310S, C351S, C369SPromoterpTRCAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKDC.118
Plasmid#227188PurposeT7 IPTG-driven Cas13aDepositorInsertLbuCas13a
UseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUdOm7.1
Plasmid#210287PurposeEmpty backbone with zeocin resistance for high expression in mammalian cellsDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMammalianMutationPromoterCMVAvailable sinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUdOm8.1
Plasmid#210288PurposeEmpty backbone with zeocin resistance for high expression in mammalian cellsDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMammalianMutationPromoterCMVAvailable sinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUdOm2.0
Plasmid#210300PurposeEmpty backbone with ampicillin resistance for high expression in mammalian cells with an added 5'UTRDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMammalianMutationPromoterCMVAvailable sinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
PXP
Plasmid#217910PurposeA plasmid encoding the hydrogel-forming protein PXPDepositorInsertPXP
UseTags6x His (N and C term)ExpressionBacterialMutationPromoterT5Available sinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
Ub-LPNTG-pET
Plasmid#221850PurposeExpresses Ub with sortase motif and His tagDepositorInsertUbiquitin
UseTagsExpressionBacterialMutationArg74ProLeuThrPromoterAvailable sinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-AzaM
Plasmid#224428PurposeExpress AzaM in E. coliDepositorInsertazaM
UseTagsHis6ExpressionBacterialMutationPromoterAvailable sinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-AzaC
Plasmid#224424PurposeExpress AzaC in E. coliDepositorInsertazaC
UseTagsHis6ExpressionBacterialMutationPromoterAvailable sinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-AzaD
Plasmid#224425PurposeExpress AzaD in E. coliDepositorInsertazaD
UseTagsHis6ExpressionBacterialMutationPromoterAvailable sinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only