We narrowed to 8,888 results for: tre promoter
-
Plasmid#127191PurposePiggybac transposon plasmid with CAG promoter GFP-Galectin 8 (GFP-Gal8) fusion protein. Useful as genetically encoded endosomal escape sensor.DepositorInsertGFP-Gal8 (LGALS8 Human)
UseTagsGal8 is fused to the c-terminus of GFPExpressionMammalianMutationPromoterCMVAvailable sinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1a-hSNCA
Plasmid#170445PurposeLentiviral vector expressing human SNCA, under control of EF1alpha promoter.DepositorInserthuman SNCA (SNCA Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.BSD
Plasmid#57821PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Blasticidin resistance, EFS Promoter drivenDepositorInsertsUseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterAvailable sinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hMECP2-cycle3GFP
Plasmid#163706PurposepAAV plasmid for Cre-dependent expression of human MECP2 fused with cycle3 GFP under Syn promoterDepositorInserthMECP2-cycle3GFP (MECP2 Aequorea victoria, Human)
UseAAVTagsExpressionMutationPromoterhSynAvailable sinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
Donor_ANKRD1_KO_Puro
Plasmid#186667PurposeDonor plasmid to endogenously knock out the ANKRD1 in Hek293 cells. eEF1a promoter, puromycin and polyA sequence is inserted between two homology arms.DepositorInsertANKRD1 KO Puromycin (ANKRD1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-Kir2.1-P2A-EGFP
Plasmid#176278PurposeViral vector for co-expression of Kir2.1 and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertKir2.1-P2A-EGFP (Kcnj2 Mouse, Synthetic)
UseAAV and Cre/LoxTagsMycExpressionMammalianMutationPromoterhuman Synapsin IAvailable sinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.PAC
Plasmid#58329PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Puromycin resistance, EFS Promoter drivenDepositorInsertsUseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterAvailable sinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CNTF-HA
Plasmid#195517PurposeExpresses HA-tagged CNTF in mammalian cellsDepositorInsertCiliary neurotrophic factor (CNTF Human)
UseAAVTagsHA-tag and NGF signal peptideExpressionMammalianMutationPromoterUbC promoter with beta-globin intronAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mATP2B1
Plasmid#60789PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains ATP2B1 3' UTR and mutated miR-155 sitesDepositorInsertATP2B1 3'UTR and mutated miR-155 binding site (ATP2B1 Human)
UseLuciferaseTagsExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available sinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV superYFP-AURKA K162M-mTurq2
Plasmid#157773PurposeExpression of AuroraA kinase-dead biosensor under CMV promoterDepositorInsertAURKA (AURKA Human)
UseTagsmTurquoise2 and superYFPExpressionMammalianMutationAURKA K162M is a kinase-dead version of AURKAPromoterCMVAvailable sinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
synapsin-hIRβ-mCherry
Plasmid#228449PurposeExpressing a truncated, constitutively active human insulin receptor (IRβ) with mCherry in rat primary hippocampal neuronsDepositorInserthuman Insulin Receptor beta subunit (INSR Human)
UseAAVTagsExpressionMutationPromoterneuron-specific synapsin promoteAvailable sinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro cTnT CCND2-T2A-ChloC
Plasmid#179841Purposedonor plasmid for cardiac-specific CCND2-T2A-Chloc expression in human cellsDepositorInsertCCND2 (CCND2 Human)
UseCRISPR and TALEN; Donor plasmidTagschloride-conducting ChR (ChloC)ExpressionMammalianMutationPromoterTroponin T promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro cTnT CCND2-T2A-iChloC
Plasmid#179842Purposedonor plasmid for cardiac-specific CCND2-T2A-iChloc expression in human cellsDepositorInsertCCND2 (CCND2 Human)
UseCRISPR and TALEN; Donor plasmidTagsimproved chloride-conducting ChR (iChloC)ExpressionMammalianMutationPromoterTroponin T promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro cTnT CCND2-T2A-luciferase
Plasmid#179844Purposedonor plasmid for cardiac-specific CCND2-T2A-luciferase expression in human cellsDepositorInsertCCND2 (CCND2 Human)
UseCRISPR, Luciferase, and TALEN ; Donor plasmidTagsluciferaseExpressionMammalianMutationPromoterTroponin T promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Hb9-CD14
Plasmid#204344PurposeKnock-in vector to insert a motor neuron-specific MACS-sortable genetic reporter into the AAVS1 locus in human pluripotent stem cells. Allows isolation of human iPSC-derived motor neurons.DepositorInserthuman CD14 (CD14 Human)
UseTagsExpressionMammalianMutationPromotermouse Hb9 (Mnx1) 9kb promoter fragmentAvailable sinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1664 - pAAV SYN1 mGas6(delta)-Myc-DDK
Plasmid#202541PurposeAn adeno-associated viral vector expressing murine Gas6 with deletion of (F50-E275) fused Myc and DDK epitopes from a synapsin promoterDepositorInsertGas6 (Gas6 Mouse)
UseAAVTagsMyc-DDKExpressionMutationDeletion of F50-E275PromoterSYN1Available sinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
Donor_ANKRD1_KO_Hygro
Plasmid#186668PurposeDonor plasmid to endogenously knock out the ANKRD1 in Hek293 cells. eEF1a promoter, hygromycin and polyA sequence is inserted between two homology arms.DepositorInsertANKRD1 KO Hygromycin (ANKRD1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV ShadowG-AURKA K162M-mTurq2
Plasmid#157769PurposeExpression of AuroraA kinase-dead biosensor under CMV promoterDepositorInsertAURKA (AURKA Human)
UseTagsmTurquoise2 and shadowGExpressionMammalianMutationAURKA K162M is a kinase-dead version of AURKAPromoterCMVAvailable sinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV ShadowY-AURKA K162M-mTurq2
Plasmid#157771PurposeExpression of AuroraA kinase-dead biosensor under CMV promoterDepositorInsertAURKA (AURKA Human)
UseTagsmTurquoise2 and shadowYExpressionMammalianMutationAURKA K162M is a kinase-dead version of AURKAPromoterCMVAvailable sinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGK-Ptrf-mKate2
Plasmid#128765PurposeFluorescent mKate reporter for PtrfDepositorInsertPtrf promoter (Cavin1 Mouse)
UseTagsExpressionMammalianMutationPromoterPtrfAvailable sinceNov. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC293 - pAAV EF1a V5-synuclein (WT)
Plasmid#60057PurposeAn AAV packaging vector that expresses wildtype alpha-synuclein under control of the EF1a promoter.DepositorInsertalpha-synuclein (SNCA human, Human)
UseAAVTagsV5ExpressionMammalianMutationPromoterEF1aAvailable sinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-aSYNUCLEIN A53T
Plasmid#227004PurposeAAV transfer plasmid encoding the human A53T mutant α-SYN under the control of the CMVie enhanced synapsin1 promoterDepositorInsertalpha synuclein A53T mutant (SNCA Human, Synthetic)
UseAAVTagsExpressionMutationA53TPromoterCMVenh synapsinAvailable sinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-Kir2.1MUT-P2A-EGFP
Plasmid#176279PurposeViral vector for co-expression of non-functional Kir2.1 and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertKir2.1MUT-P2A-EGFP (Kcnj2 Mouse, Synthetic)
UseAAV and Cre/LoxTagsMycExpressionMammalianMutationGYG to AAA (aa144-146)Promoterhuman Synapsin IAvailable sinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMX-mPGK-CD90.2-Rluc_miR
Plasmid#163332PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the murine PGK promoter.DepositorInsertCD90.2 (Thy1 Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromotermPGKAvailable sinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMY-CD90.2-Rluc_miR
Plasmid#163333PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the LTR promoter.DepositorInsertCD90.2 (Thy1 Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterLTRAvailable sinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro cTnT CCND2-T2A-ChloC-P2A-eGFP
Plasmid#179840Purposedonor plasmid for cardiac-specific CCND2-T2A-Chloc-P2A-eGFP expression in human cellsDepositorInsertCCND2 (CCND2 Human)
UseCRISPR and TALEN; Donor plasmidTagschloride-conducting ChR (ChloC) and eGFPExpressionMammalianMutationPromoterTroponin T promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMX-CAG-CD90.2-Rluc_miR
Plasmid#163331PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the CAG promoter.DepositorInsertCD90.2 (Thy1 Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterCAGAvailable sinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hFTH1-CD90.2-Rluc_miR
Plasmid#163330PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the human FTH1 promoter.DepositorInsertCD90.2 (Thy1 Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterhFTH1Available sinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hPGK-CD90.2-Rluc_miR
Plasmid#163329PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the human PGK promoter.DepositorInsertCD90.2 (Thy1 Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterhPGKAvailable sinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMY-CD90.2-Cd247A_miR
Plasmid#163328PurposeRetroviral vector for knockdown of murine CD247A (TCR zeta) and expression of a CD90.2 surface marker under control of the LTR promoter.DepositorInsertCD90.2 (Thy1 Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterLTRAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-CAG-CD90.2-Cd247A_miR
Plasmid#163326PurposeRetroviral vector for knockdown of murine CD247A (TCR zeta) and expression of a CD90.2 surface marker under control of the CAG promoter.DepositorInsertCD90.2 (Thy1 Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterCAGAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-mPGK-CD90.2-Cd247A_miR
Plasmid#163327PurposeRetroviral vector for knockdown of murine CD247A (TCR zeta) and expression of a CD90.2 surface marker under control of the murine PGK promoter.DepositorInsertCD90.2 (Thy1 Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromotermPGKAvailable sinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hFTH1-CD90.2-Cd247A_miR
Plasmid#163325PurposeRetroviral vector for knockdown of murine CD247A (TCR zeta) and expression of a CD90.2 surface marker under control of the human FTH1 promoter.DepositorInsertCD90.2 (Thy1 Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterhFTH1Available sinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hPGK-CD90.2-Cd247A_miR
Plasmid#163324PurposeRetroviral vector for knockdown of murine CD247A (TCR zeta) and expression of a CD90.2 surface marker under control of the human PGK promoter.DepositorInsertCD90.2 (Thy1 Mouse)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterhPGKAvailable sinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEMS1214
Plasmid#29108PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorInsertPle96 (GPX3 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSExpressionMutationPromoterAvailable sinceOct. 3, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1225
Plasmid#29113PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorInsertPle243 (VIM Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSExpressionMutationPromoterAvailable sinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1228
Plasmid#29114PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorInsertPle246 (VIM Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSExpressionMutationPromoterAvailable sinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1052
Plasmid#29004PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorInsertPle112 (HCRT Human)
UsePleiades promoter project [sic, pleaides plieades]TagsCre-EGFP-NLSExpressionMutationPromoterAvailable sinceAug. 4, 2011AvailabilityAcademic Institutions and Nonprofits only