We narrowed to 18,106 results for: Mut
-
Plasmid#58684PurposeExpresses LGP2 with a mutation to motif IIa in mammalian cellsDepositorInsertLGP2-MIIa (DHX58 Human)
UseTags3x FLAGExpressionMammalianMutationmutation to Motif IIA, K138E and Y142FPromoterCMVAvailable SinceJuly 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K5S-Mt344B
Plasmid#34602DepositorInsertKLF4 (KLF4 Human)
UseLuciferaseTagsExpressionMammalianMutationThe KLF4 K5S region was mutated at the miR-344 bi…PromoterCMVAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K5S-Mt206A
Plasmid#34599DepositorInsertKLF4 (KLF4 Human)
UseLuciferaseTagsExpressionMammalianMutationThe KLF4 K5S region was mutated at the miR-206 bi…PromoterCMVAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLenti-puro/RAF1-P207S
Plasmid#131726PurposeMammalian Expression of RAF1DepositorAvailable SinceAvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-mVenus-p27K−
Plasmid#176651PurposeIt encodes an mVenus fused to a mutant p27K-, which lacks binding affinity to Cdk. This reporter helps to identify quiescent disseminated tumor cells (in G0 phase of cell cycle).DepositorInsertmVenus-p27K- (Cdkn1b Mouse)
UseLentiviralTagsmVenusExpressionMutationMutant K- (lacks affinity to Cdk)PromoterAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PIK3CA-E545K
Plasmid#116485PurposeLentiviral expression of PIK3CA E545KDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_PIK3CA_p.H1047R
Plasmid#82824PurposeGateway Donor vector containing PIK3CA, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EGFR-E746_T751delinsA
Plasmid#116246PurposeLentiviral expression of EGFR E746_T751delinsADepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EGFR-L858R
Plasmid#116276PurposeLentiviral expression of EGFR L858RDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_HAVCR2_WT
Plasmid#82893PurposeGateway Donor vector containing HAVCR2, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ESR1
Plasmid#116737PurposeLentiviral expression of ESR1DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ESR1-Y537S
Plasmid#116374PurposeLentiviral expression of ESR1 Y537SDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1a-mCherry-EGFP-LC3B
Plasmid#170446PurposeLentiviral vector expressing tandem mCherry-EGFP-LC3B in mamalian cell. To visualize free autophagosome and autophagosomes that have fused with the lysosome.DepositorAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-PEmax-IRES-ZeoR
Plasmid#207353PurposeLentiviral transfer plasmid containing CMV-driven expression cassette encoding PEmax enzyme for prime editing.DepositorInsertPrime editor max (PEmax) enzyme
UseLentiviralTagsExpressionMutationPromoterAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EGFR
Plasmid#116731PurposeLentiviral expression of EGFRDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ESR1-Y537N
Plasmid#116373PurposeLentiviral expression of ESR1 Y537NDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FuG-E (P440E)
Plasmid#119978PurposeThis is an envelope gene encoding plasmid to make retrogradely lentiviral vector. If you use this plasmid, you can make type E (P440E) envelope coating virus particle with NeuRet.DepositorInsertFusion Glycoprotein type E (P440E)
UseLentiviralTagsFusion protein of Vesicular stomatitis Indiana vi…ExpressionMutationPromoterCAGGSAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EPHA2
Plasmid#116732PurposeLentiviral expression of EPHA2DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-AXL
Plasmid#116714PurposeLentiviral expression of AXLDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_MDM2_WT
Plasmid#82897PurposeGateway Donor vector containing MDM2, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETDuet_huCAD_ICADL (TevS)
Plasmid#100098Purposedual expression of human CAD and ICAD. The two caspase cleavage sites in ICAD were mutated to TEVP cleavable sequencesDepositorUseTagsExpressionBacterialMutationtwo caspase cleavage sites (DETD-117 and DAVD-224…PromoterT7Available SinceJan. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ESR1-Y537C
Plasmid#116372PurposeLentiviral expression of ESR1 Y537CDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ESR1-L536Q
Plasmid#116369PurposeLentiviral expression of ESR1 L536QDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a-L274GMmMetRS-T2A-mCherry
Plasmid#220800PurposeLentivirus expressing mutant tRNA synthetase for incorporation of noncanonical amino acids in nascent proteins plus mCherry reporter and puro resistanceDepositorInsertMars1 (Mars1 Mouse)
UseLentiviralTags2xFLAG and T2A-mCherryExpressionMutationmutation in MetRS to change aa 274 from L to GPromoterEF1aAvailable SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-YFP-KRAS4B
Plasmid#112718PurposeExpresses YFP-KRAS4B fusion protein used for FRET studies in eukaryotic cells.DepositorAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-DDX3X
Plasmid#116730PurposeLentiviral expression of DDX3XDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_EGFR_p.L858R
Plasmid#82906PurposeGateway Donor vector containing EGFR, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3ExpressionMutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…PromoterAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-8:TOMM20-mEGFP
Plasmid#87423PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human TOMM20DepositorInsertTOMM20 Homology Arms with linker-mEGFP (TOMM20 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …PromoterAvailable SinceMarch 15, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHAGE-PIK3CA-H1047R
Plasmid#116500PurposeLentiviral expression of PIK3CA H1047RDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-pro-Il1b-C-Flag
Plasmid#75131PurposeExpresses C-terminal flag-tagged pro-IL-1β in mammalian cellsDepositorInsertinterleukin 1 beta (Il1b Mouse)
UseTags3XFLAGExpressionMammalianMutation(please see depositor comments below)PromoterCMVAvailable SinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21b(+)-Is-PETase-W159H-S238F
Plasmid#112203PurposepET-21b(+) based plasmid for expression of PETase from Ideonella sakaiensis 201-F6 (Genbank GAP38373.1) with W159H and S238F mutations, codon optimized for expression in E. coli K12DepositorInsertPETase gene from Ideonella sakaiensis 201-F6 with W159H and S238F mutations, codon optimized for expression in E. coli K12
UseTags6XHISExpressionBacterialMutationW159H, S238FPromoterN/AAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-C-flag_huntingtin_full-length_Q30
Plasmid#111744PurposeBaculovirus transfer vector for expression of huntingtin protein in insect and mammalian cellscells as well as in mammalian cellsDepositorInsertHTT (HTT Human)
UseBaculovirus expressionTagsFLAGExpressionMammalianMutationQ30 (polyQ repeat)PromoterCMV and P10Available SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ERBB3
Plasmid#116735PurposeLentiviral expression of ERBB3DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A CRFR1 95TAG 263TAA-HA
Plasmid#154781Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and rat CRFR1 95TAG 263TAA, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertCRFR1 (Crhr1 Rat)
UseTagsHAExpressionMammalianMutation95TAG 263TAA in CRFR1-HA, hybrid PylT with A41AA …PromoterEF1Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A CRFR1 95TAA 263TAG-HA
Plasmid#154780Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and rat CRFR1 95TAA 263TAG, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertCRFR1 (Crhr1 Rat)
UseTagsHAExpressionMammalianMutation95TAA 263TAG in CRFR1-HA, hybrid PylT with A41AA …PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EGFR-T790M
Plasmid#116310PurposeLentiviral expression of EGFR T790MDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_MYC_WT
Plasmid#82927PurposeGateway Donor vector containing MYC, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-C-flag_huntingtin_full-length_Q42
Plasmid#111746PurposeBaculovirus transfer vector for expression of huntingtin protein in insect and mammalian cellscells as well as in mammalian cellsDepositorInsertHTT (HTT Human)
UseBaculovirus expressionTagsFLAGExpressionMammalianMutationQ42 (polyQ repeat)PromoterCMV and P10Available SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GCaMP5G
Plasmid#31788Purposea single-wavelength GCaMP3-based calcium indicator with improved response. Please also see the GCaMP6s/m/f indicators.DepositorInsertGCaMP5G
UseTags6xHis, T7 epitope, and Xpress tagExpressionMammalianMutationPromoterCMVAvailable SinceAug. 22, 2011AvailabilityAcademic Institutions and Nonprofits only