We narrowed to 3,282 results for: cgas
-
Plasmid#226188PurposeExpression mappingDepositorInsertSyn Barcode14
UseAAVTagsExpressionMutationPromoterAvailable sinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV syn Barcode1
Plasmid#229062PurposeExpression mappingDepositorInsertSyn Barcode1
UseAAVTagsExpressionMutationPromoterAvailable sinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode21
Plasmid#226194PurposeExpression mappingDepositorInsertSyn Barcode21
UseAAVTagsExpressionMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode22
Plasmid#226193PurposeExpression mappingDepositorInsertSyn Barcode22
UseAAVTagsExpressionMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode20
Plasmid#226192PurposeExpression mappingDepositorInsertSyn Barcode20
UseAAVTagsExpressionMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
Banshee shRandom mCherry
Plasmid#80145Purposeretroviral expression of random shRNADepositorInsertrandom shRNA
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_1
Plasmid#192685PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a, U6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_hup53_Ex5
Plasmid#85539PurposeInducible expression of guide RNA (hup53_Ex5) with fluorescent GFP reporterDepositorInserthup53 Ex5
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterH1tAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1A
Plasmid#185382PurposeFor mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1ADepositorInsertPPM1A (PPM1A Human)
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgSik3_1st-hU6-sgNT
Plasmid#177214PurposeExpresses a Sik3-targeting and a non-targeting gRNAs and Cre-recombinaseDepositorInsertsgSik3_1st/sgNT1
UseLentiviralTagsExpressionMutationPromotermU6/hU6Available sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ERF922
Plasmid#126883PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCfb13207
Plasmid#219882PurposeThe base plasmid of TUNEYALI for TF17DepositorInsertContains gRNA targeting TF17 (YALI1_B19962g) and homologous arm matching TF17
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Pi21
Plasmid#126904PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ Pi21
Plasmid#126892PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ PLDbeta1
Plasmid#126890PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ WRKY28_1
Plasmid#126887PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Dja6_2
Plasmid#126895PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ WRKY28_1
Plasmid#126899PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ PLDbeta1
Plasmid#126902PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Dja6_1
Plasmid#126894PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only