We narrowed to 8,624 results for: FIE
-
Plasmid#206878PurposeThe ORF of HNF4α (variant 2) cDNA amplified from the RT human liver RNA was cloned at the Bam HI/XbaI sites of the pcDNA3.1(+), the mammalian expression vector.DepositorAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pET11a_His-TEV-PLpro (nsp3) (SARS-CoV-2)
Plasmid#169192PurposeTo express SARS-CoV-2 Papain-like protease in E. coliDepositorInsert6His-TEV-nsp3_E746-K1060 (pp1ab_E1564-K1878) (ORF1ab SARS-CoV-2, Synthetic)
UseUnspecifiedTags6His-TEVMutationCodon optimised for E. coliPromoterT7Available SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYeDP60-hATP13A2-E343A
Plasmid#171378PurposeA modified pYEDP60 plasmid containing a yeast codon-optimized version of human ATP13A2 variant 2 E343A mutant, followed by a thrombin cleavage site and a C-term BAD tag. DOI: 10.21769/BioProtoc.3888DepositorInserthuman ATP13A2 variant 2 wild-type
TagsBAD tagExpressionYeastMutationE343APromoterURA3Available SinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7NT*-Bri2 113-231 R221E
Plasmid#138134PurposeExpresseds human Bri2 BRICHOS R221E mutant in E. coliDepositorInserthuman Bri2 BRICHOS R221E (ITM2B Human)
TagsNT* tag derived from spider silk proteinsExpressionBacterialPromoterT7Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [Chronos-tdTomato]
Plasmid#84481PurposeAAV-mediated expression of Chronos-tdTomato under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal. tdTomato is a codon diversified version.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-ChrimsonR-tdTomato
Plasmid#122064PurposeAAV-mediated expression of ChrimsonR-tdTomato under the EF1α promoter (1.1kb short version).tdTomato has codons varied to reduce recombination. Using SV40 pA signal.DepositorInsertChrimsonR-tdTomato
UseAAVTagstdTomato (codon diversified version)ExpressionMammalianMutationChrimson K176R mutantPromoterEF1a(1.1kb short version)Available SinceNov. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
mEos3.2GG
Plasmid#203756PurposeEncodes a modified version of the membrane anchor of KRas, including the last 16 residues of the C terminus, with mEos3.2 fused to the N terminus. The base pairs encoding the CAAX box for KRas were replaced by the CAAX box from rap1B, resulting in a geranylgeranylation instead of farnesylation. Used as a fluorescent plasma membrane probe.DepositorAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRM14
Plasmid#163693Purposehsp70 promoter inducible expression of DHB:mNeonGreen-P2A-H2B:mScarletDepositorUseUnspecified; Zebrafish expressionTagsmNeonGreen and mScarletPromoterHSP70Available SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCag FlpO-2A-Cre EV
Plasmid#129419Purposeepisomal expression of FlpO and Cre recombinasesDepositorInsertFlpO-2A-Cre
UseCre/Lox and Unspecified; Episomal expression vect…ExpressionMammalianPromoterCMV/Chick β-actin (CAG)Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPB-tetO(hCMV1)-HA-Tet1(201R2)-IV
Plasmid#102421PurposeInducible expression of siRNA resistant mouse Tet1-201 (Ensembl transcript ENSMUST00000050826.13) with HA-tag and IRES-Venus in piggyBac (PB) transposon vectorDepositorInsertTet1 (Tet1 Mouse)
TagsHAExpressionMammalianMutationModified at the Dharmacon SMARTpool siRNA #2 targ…PromoterTetO-CMVAvailable SinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPB-tetO(hCMV1)-HA-Tet1mHxD(201R2)-IV
Plasmid#102422PurposeInducible expression of siRNA resistant mouse Tet1-201 (ENSMUST00000050826.13) with mutated catalytic domain (H1620Y & D1622A), HA-tag and IRES-Venus in piggyBac (PB) transposon vectorDepositorInsertTet1 catalytic domain mutant (Tet1 Mouse)
TagsHAExpressionMammalianMutationH1620Y and D1622A mutations in Tet1 catalytic dom…PromoterTetO-CMVAvailable SinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTripz NEO DEST
Plasmid#209072PurposeModified DOX-ON inducible destination vector with a c-terminal 3X flag tag to be used for LR recombination reactions to inducibly express cDNAs of interestDepositorTypeEmpty backboneUseLentiviral; Gateway destination vector to be used…Tags3X FLAGPromoterCMVAvailable SinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSIN-hSNCA-NE
Plasmid#102366PurposeLentiviral overexpression of synuclein alphaDepositorInsertsynuclein alpha (SNCA Human)
UseLentiviralTagsNEExpressionMammalianMutationA silent mutation (333bp downstream of ATG) was i…PromoterEF-1aAvailable SinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBK2045-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(CMV-gRNA1)
Plasmid#223165Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting CMVDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Puro-HEK3 CTT ins
Plasmid#171996PurposeDelivers all prime editing (nickase) components targeting the HEK3 site for a CTT inserrtion, in a single, puromycin selectable plasmidDepositorInsertCbH-Cas9(H840A)-RT-T2A-Puro, hU6-pegRNA HEK3 CTT ins, hU6-sgRNA HEK3 +90
ExpressionMammalianPromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-fd [ChrimsonR-tdTomato]
Plasmid#84483PurposeAAV-mediated expression of ChrimsonR-tdTomato under the Syn promoter, in floxed/forward (Cre-dependent) manner. Cre turns gene off. Using bGHpA signal. tdTomato is a codon diversified version.DepositorInsertChrimsonR-tdTomato
UseAAVTagstdTomatoExpressionMammalianMutationChrimson K176R mutantPromoterhuman synapsin promoterAvailable SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
XLone-Puro beta-catenin P2A eGFP-NLS
Plasmid#155189PurposePiggybacTransposon-based tunable and temporal expression control of mutated beta-catenin and nuclear eGFPDepositorInsertbeta-catenin (Ctnnb1 Mouse)
UseUnspecified; Piggybac transposonTagsP2A eGFP NLSExpressionMammalianMutationSites phosphorylated by GSK-3beta have been mutat…PromoterTRE3GAvailable SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-FLPX-rc [ChrimsonR-tdTomato]
Plasmid#128589PurposeAAV-mediated expression of ChrimsonR-tdTomato under the Syn promoter in frt/reversed (Flp-dependent) manner. tdTomato has codons varied to reduce recombination.DepositorHas ServiceAAV8InsertChrimsonR-tdTomato
UseAAVTagstdTomato (codon diversified version)ExpressionMammalianMutationChrimson K176R mutantPromoterSynAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDN-D2irTNG4kwh
Plasmid#44722DepositorInsertspCMV-D2i promoter
htetR::NLS::EGFP
UseSynthetic Biology; Expression regulator/reporter;…TagsRabbit β-globin intron II and WPREExpressionMammalianMutationInitiator motif (Inr) displaced relative to pCMV-…PromoterpCMV-D2iAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α1.1-FLPX-rc [ChrimsonR-tdTomato]
Plasmid#128587PurposeAAV-mediated expression of ChrimsonR-tdTomato under the EF1α1.1 promoter in frt/reversed (Flp-dependent) manner. tdTomato has codons varied to reduce recombination.DepositorInsertChrimsonR-tdTomato
UseAAVTagstdTomato (codon diversified version)ExpressionMammalianMutationChrimson K176R mutantPromoterEF1α (1.1 kb short version)Available SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBK2047-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA2)
Plasmid#223167Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA2 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETM30-ARC105
Plasmid#133426PurposeHuman ARC105 coding sequence in vector for in vitro transcription and protein expression, with T7 promoter.DepositorInsertPCQAP (MED15 Human)
ExpressionBacterialMutationContains amino acids 5-78 fused to C-terminal of …Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmSTING
Plasmid#208386PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine STING gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:IL2_SigP:NLuc
Plasmid#197266PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human IL2 locus (exon 3). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertInterleukin-2 homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-beta-5 in pcDNAI/Amp
Plasmid#55708PurposeAn amino-terminal fragment of mCerulean was fused to Gbeta5. When co-expressed with a carboxyl terminal CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertmCer(1-158)-beta5 (GNB5 Aequorea victoria, Human)
TagsCer(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationGBeta-5 was amplified via PCR, which added an N-t…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-Puro HEK3 CTT ins
Plasmid#171995PurposeDelivers all prime editing nuclease components targeting the HEK3 gene for a CTT inserrtion, in a single, puromycin selectable plasmidDepositorInsertHEK3 CTT insertion pegRNA and CbH-Cas9-RT-T2A-Puro, hU6-pegRNA HEK3 CTT ins, hU6-sgRNA sham
ExpressionMammalianPromoterCMV for Cas9, U6 for gRNAsAvailable SinceSept. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:NEAT1-v2_SigP:NLuc
Plasmid#197268PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human NEAT1 locus (long isoform only). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertNEAT1-v2 homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_FLuc_loxP-PuroR
Plasmid#177866PurposeCloning Backbone for Firefly-luciferase-based EXSISERS containing loxP-sites flanked PuroR cassetteDepositorInsertFLuc-based EXSISERS
UseCRISPR, Cre/Lox, Luciferase, Synthetic Biology, a…TagsFLAGExpressionMammalianAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 ATP5O(TISU)-FF
Plasmid#85489PurposeFirefly luciferase under the control of ATP5O TISUDepositorInsertFull TISU element of ATP5O (ATP5PO Human)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutation2nd and 3rd codon of luciferase were modified fro…Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEAHISMRSA0482
Plasmid#96968Purposeexpression of methicillin-resistant Staphylococcus aureus orf 0482DepositorInsertMRSA ORF0482
TagsN-ter TEV protease cleavable 6HisExpressionBacterialMutationnonePromoterT7Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-gamma-2 in pcDNAI/Amp
Plasmid#55762PurposeAn amino-terminal YFP fragment was fused to Ggamma2. When co-expressed with a carboxyl terminal YFP or CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(1-158)-gamma-2 (GNG2 Aequorea victoria, Human)
TagsYFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationYFP (1-158) includes a substitution of Met for Gl…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEAHISMRSA2028
Plasmid#97001PurposeExpressing MRSA Asp/Tyr/Phe pyridoxal-50- phosphate-dependent aminotransferaseDepositorInsertAsp/Tyr/Phe pyridoxal-50- phosphate-dependent aminotransferase
TagsN-ter TEV protease cleavable 6HisMutationnonePromoterT7Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPgk-mTDGa-BioID2-HA
Plasmid#232030Purposemammalian expression (murine Pgk promoter) of murine TDG fused to BioID2-HADepositorTagsNLSExpressionMammalianMutationPgk1 promoter variantPromoterPgk1 promoterAvailable SinceNov. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-hCAII
Plasmid#232480PurposeTetracycline inducible PiggyBac vector expressing human CAII gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHuman carbonic anhydrase II (CA2 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBK1876-AAV-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA2)
Plasmid#223162PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and gRNA2 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1861-AAV-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA1)
Plasmid#223161PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK2046-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA1)
Plasmid#223166Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmATM
Plasmid#208392PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ATM gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:NEAT1-total_SigP:NLuc
Plasmid#197267PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human NEAT1 locus (both isoforms). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertNEAT1-total homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only