We narrowed to 7,219 results for: cas9 plasmid
-
Plasmid#223112PurposepCMV and pT7 Human expression plasmid for ABE8e SpCas9 enzyme with KWRQLC amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadA8e-SpCas9(KWRQLC)-P2A-EGFP
UseCRISPRTagsBPNLS-P2A-EGFP and BPNLS-TadA8eExpressionMammalianMutationTadA8e mutations; nSpCas9(D10A/KWRQLC)=D1135K, S1…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9(MRKCRS)-P2A-EGFP (BKS1034)
Plasmid#223117PurposepCMV and pT7 Human expression plasmid for ABE8e using SpCas9 enzyme with MRKCRS amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadA8e-SpCas9(MRKCRS)-P2A-EGFP
UseCRISPRTagsBPNLS-P2A-EGFP and BPNLS-TadA8eExpressionMammalianMutationTadA8e mutations; nSpCas9(D10A/MRKCRS)=D1135M, S1…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
dCas9 fused to nanobody (anti-beta catenin)
Plasmid#186420PurposeExpression of dCas9 with C-terminal nanobody fusion recognizing beta catenin tagDepositorInsertdCas9-nanobody fusion (anti-beta catenin)
UseCRISPRTags6HisAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-Cas9-P2A-Puro_NFATC2-sgRNA
Plasmid#188704PurposeLentivirus transfer plasmid encoding Cas9, puromycin resistance, and 4 sgRNAs targeting human NFATC2DepositorInsertNFATC2 sgRNAs
UseLentiviralExpressionMammalianPromoterhUbCAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)_g1_CASH-1
Plasmid#188975PurposeA human codon-optimized SpCas9 nickase and chimeric g1 guide RNA expression plasmid.DepositorInsertg1 guide RNA
ExpressionMammalianAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)_g2_CASH-1
Plasmid#188976PurposeA human codon-optimized SpCas9 nickase and chimeric g2 guide RNA expression plasmid.DepositorInsertg2 guide RNA
ExpressionMammalianAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA
Plasmid#73796PurposepRS416 Ura marked Cen/Ars plasmid with dCas9-Mxi1 under Tef1 promoter, and tet-incucibile RPR1 promoter with NotI cloning site adjacent to gRNADepositorInsertsdCas9-Mxi1
Tet Repressor
Structural gRNA for S pyogenes
UseCRISPRTagsMxi1 and NLSExpressionYeastMutationD10A, H840APromoterpGPM1, pRPR1(TetO), and pTef1Available SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
lenti SYN-dCas9-KRAB-MeCP2
Plasmid#155365PurposeExpresses dCas9-KRAB-MeCP2 fusion driven by human SYN promoterDepositorInsertdCas9-KRAB-MeCP2
UseCRISPR and LentiviralTags3x FLAG and 7x HisExpressionMammalianPromoterSYNAvailable SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
(559) pAAV EF-1a KRAB-SadCas9 U6-gRNA
Plasmid#163024PurposeExpression of CRISPRi with U6-gRNA (Bsa1 sites)DepositorInsertMammalian codon-optimized SadCas9
UseAAVTagsKRAB, SV40 polyA, and myc NLSExpressionMammalianPromoterhEF-1aAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
PRDM9dC(KRAB-SSXRD-PR/SET-dC)-Cas9
Plasmid#186699PurposePlasmid encoding PRDM9dC-Cas9 fusion under CMV promoterDepositorInsertPRDM9dC(KRAB-SSXRD-PR/SET-dC)-Cas9 (PRDM9 Human)
UseCRISPRTagsFLAGExpressionMammalianPromoterCMVAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-ABE-3'UTR-sgRNA-2xMS2
Plasmid#132554PurposeVector plasmid expressing ABEmax and sgRNA scaffold with MS2 replacing the Tetraloop and loop 2DepositorInsertsABEmax
sgRNA, with Tetraloop and loop 2 replaced by MS2 aptamer
ExpressionMammalianAvailable SinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SauriCas9-KKH-Puro
Plasmid#135966PurposeExpresses SauriCas9-KKH and puromycin resistance genes, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6.gDNMT1.Cas9-T2A-GFP
Plasmid#170362PurposePlasmid used for Crispr/cas9 based disruption of human DNMT1.DepositorInsertCas9-T2A-GFP
UseLentiviralAvailable SinceJune 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-eSpCas9 (without sgRNA)
Plasmid#92354PurposeExpression plasmid for human codon-optimized high-fidelity eSpCas9 (without U6-sgRNA coding sequence)DepositorInsert3xFLAG-NLS-Streptococcus pyogenes enhanced Cas9-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationK848A, K1003A, R1060APromoterCbhAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
p1193-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIC3Nme_FLAG_NLS-3XmiR122BS
Plasmid#129531PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIC3Nme with 3x miR-122 binding sites in 3' UTRDepositorInsertscodon-optimized AcrIIC3Nme
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-T2A-mNeonGreen-2-bc6
Plasmid#250524PurposeExpresses Cas9 and mNeonGreen. Barcode is added to the vector.DepositorInsertM13F-AATTGGCC
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-hUV6-sgRNA-dCas9-KRAB-TagBFP2 (identifier AAAA-0244)
Plasmid#202553PurposeNontargeting control vector with TagBFP2DepositorInsertHumanized dCas9-KRAB-TagBFP2 (tag blue fluorescent protein 2) (TRIM28 S. Pyogenes (dCas9), H. sapiens (KRAB), Entacmaea quadricolor (TagBFP2))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2MutationPuromycin-resistance gene in the pLV hU6-sgRNA hU…Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC18-mini-Tn7T-Plac-dCas9 (Plac)
Plasmid#105235PurposeTn7 integrating plasmid with S. pasteurianus dCas9 expressed from the Plac promoter for expression in P. aeruginosaDepositorInsertS. pasteurianus dCas9
UseCRISPR and Synthetic BiologyTagsHAExpressionBacterialMutationD10A, H599AAvailable SinceAug. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC18-mini-Tn7T-Lac-dCas9 (Ptac)
Plasmid#105234PurposeTn7 integrating plasmid with S. pasteurianus dCas9 expressed from the Ptac promoter for expression in P. putida and P. fluorescensDepositorInsertS. pasteurianus dCas9
UseCRISPR and Synthetic BiologyTagsHAExpressionBacterialMutationD10A, H599AAvailable SinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-Cas9-P2A-Puro_ST-sgRNA
Plasmid#188705PurposeLentivirus transfer plasmid encoding Cas9, puromycin resistance, and 4 sgRNAs targeting human safe targeting lociDepositorInsertST sgRNAs
UseLentiviralExpressionMammalianPromoterhUbCAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-EGFP (ANV)
Plasmid#71685PurposeExpression of mutant human codon-optimized dCas9-DNMT3A fusion (inactive catalytic domain of DNMT3A) with T2A-EGFP; cloning backbone for sgRNADepositorInsertS. pyogenes dCas9 fused with the inactivated (E756A) catalytic domain of human DNMT3A (amino acids P602-V912) and T2A-EGFP (DNMT3A Human, S. pyogenes, Synthetic)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-EGFPExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E756A inactiva…PromoterCBhAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX551-miniCMV-SpCas9D10A nickase
Plasmid#216735PurposeExpresses SpCas9-D10A nickase from a miniCMV promoter. For AAV packaging. Derived from pX551-miniCMV-SpCas9, which was a gift from Alex Hewitt (Addgene #107031)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterT7 and mini-CMVAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-Octo_VirD2_NLS-Cas9-6xHis
Plasmid#232296PurposeExpresses Cas9 protein fused with octopine-type VirD2-originating NLSDepositorInsertOcto_VirD2_NLS-Cas9-6xHis
UseCRISPRTags6xHis and Octopine-type VirD2-derived NLSExpressionBacterialPromoterT7Available SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Donor idCas9-KRAB-Blast
Plasmid#255020PurposeDonor plasmid targeting the AAVS1 human locus to express dCas9-KRAB upon dox inductionDepositorInsertdCas9-KRAB
Tags3x FLAGExpressionMammalianPromoterTight TREAvailable SinceMay 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-RAB7A-gRNA1 (PX459)
Plasmid#221551PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cellsDepositorAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-RAB7A-gRNA2 (PX459)
Plasmid#221552PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cellsDepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-NG-P2A-EGFP (RTW3677)
Plasmid#139994PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-NG(L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9-NG with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpCas9-NG=L1111R/D1135V/G1218R/E1219F/A1322R/R133…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP313-pAAV-CMV-SaCas9-DIO-pA
Plasmid#113690PurposeA CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9-T7-EGFP_gRNA1-T7term (BPK848)
Plasmid#181745Purposedual T7 promoter vector for bacterial expression of SpCas9 with a c-terminal NLS and 3xFLAG tag, along with an SpCas9 sgRNA targeting EGFP site 1DepositorInserthuman/zebrafish codon optimized SpCas9
UseIn vitro transcription; t7 promoterTagsNLS(SV40)-3xFLAGExpressionBacterialPromoterT7Available SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL7 lenti-dcas9-3xflag-blast
Plasmid#112133Purposelenti vector encoding dcas9-3xflag with T2A Blastcidin resistance marker (EF1a-NLS-dCas9-3Xflag-T2A-Blast-WPRE)DepositorInsertdCas9(D10A, N863A)-T2A-Blast
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A mutants in Cas9PromoterEF1aAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCAS9 wt (BB)-2A-GFP targeting human TRIM21
Plasmid#138295PurposegRNA for CRISPR/Cas9 knockout of human TRIM21DepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL8 lenti-D10Acas9-3xflag-blast
Plasmid#112134Purposelenti vector encoding D10Acas9-3xflag with T2A Blastcidin resistance marker (EF1a-NLS-D10ACas9-3Xflag-T2A-Blast-WPRE)DepositorInsertD10Acas9-3xflag-blast
UseCRISPR and LentiviralExpressionMammalianMutationD10A mutant in Cas9PromoterEF1aAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP304-pAAV-EFS-dSaCas9-VP64-pA
Plasmid#113679PurposeA EFS driven de-catalyzed SaCas9 fused to VP64 domain for increased transcription in targeted regionDepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Synthetic BiologyTagsNLS and VP64Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 SV40-CMV-SaCas9-3xNLS
Plasmid#78601PurposeAAV vector containing SaCas9DepositorInsertSV40-CMV-SaCas9-3xNLS
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoterSV40, CMV promotersAvailable SinceDec. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV N-SpyCas9-Intein, U6-gRNA scaffold (F+E)
Plasmid#120293PurposeAAV Vector for expression of N-terminal SpyCas9 fragment with Intein and a U6-driven F+E gRNA scaffoldDepositorInsertN-terminal fragment of SpyCas9
UseAAV and CRISPRTagsSV40-NLS and split-inteinExpressionMammalianAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP302-pAAV-CMV-dSaCas9-KRAB-pA
Plasmid#113677PurposeA CMV driven de-catalyzed SaCas9 fused to KRAB domain for inhibition of transcription in targeted region.DepositorInsertde-catalyzed SaCas9
UseAAV and CRISPRTagsKRAB and NLSAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP305-pAAV-EFS-dSaCas9-KRAB-pA
Plasmid#113681PurposeA EFS driven de-catalyzed SaCas9 fused to KRAB domain for inhibition of transcription in targeted region.DepositorInsertde-catalyzed SaCas9
UseAAV and CRISPRTagsKRAB and NLSAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP303-pAAV-CMV-dSaCas9-VP64-pA
Plasmid#113678PurposeA CMV driven de-catalyzed SaCas9 fused to VP64 domain for increased transcription in targeted regionDepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Synthetic BiologyTagsNLS and VP64Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2
Plasmid#78606PurposepZac2.1 CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2DepositorInsertCMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoter173CMV, U6Available SinceDec. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-spCas9
Plasmid#231404PurposeExpresses spCas9 from hSyn promoterDepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCMV-dSaCas9-VP64-pU6-sgRNA
Plasmid#158990PurposeVector G encodes pAAV-pCMV-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in mammalian cellsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRExpressionMammalianPromoterpCMVAvailable SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-KRAB-pU6-sgRNA
Plasmid#158988PurposeVector E encodes pAAV-pMecp2-dSaCas9-KRAB-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR interference in neuronsDepositorInsertdSaCas9-KRAB
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-VP64-pU6-sgRNA
Plasmid#158972PurposeVector C encodes pAAV-pMecp2-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in neuronsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceSept. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR-PGK- dCas9-SunTag-P2A-HygR
Plasmid#193137PurposeExpresses dCas9 fused to the SunTag scaffoldDepositorInsertdCas9-SunTag-T2A-HygR
UseLentiviralPromoterPGKAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-VP160-pU6-sgRNA
Plasmid#158987PurposeVector D encodes pAAV-pMecp2-dSaCas9-VP160-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in neuronsDepositorInsertdSaCas9-VP160
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only