We narrowed to 1,509 results for: U6 promoter
-
Plasmid#173211PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick exon-53 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 sgRNA + MTOR Nick exon-53 sgRNA
UseCRISPR; Prime editing (pe3)ExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_RUNX1_+4_T_to_G_Dual_pegRNA
Plasmid#173212PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and RUNX1 +4 T to G pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + RUNX1 +4 T to G pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_RUNX1_+1_ATGins_Dual_pegRNA
Plasmid#173213PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and RUNX1 +1 ATG insertion pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + RUNX1 +1 ATG insertion pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
gRNA_Cloning Vector BbsI
Plasmid#128433PurposeEmbty backbone vector for expression of gRNA for spCas9 genome editing or epigenome editingDepositorTypeEmpty backboneExpressionMammalianPromoterU6 promoterAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6_AluJb
Plasmid#240314PurposeOverexpress the consensus AluJb retrotransposon sequence from a Pol-III promoterDepositorInsertAluJB
ExpressionMammalianPromoterU6Available SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgGFP-NT1
Plasmid#46914PurposeHuman pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GFP (NT1)DepositorInsertsgGFP-NT1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_PROX1_1+3
Plasmid#121176PurposeLentiviral construct for the expression of Cas9 protein and puromycin resistance from EFS promoter and two guide RNAs targeting for deletion PROX1 start codon sequence.DepositorInsertCas9-P2A-puro and U6 promoters driven expression of gRNAs
UseCRISPR and LentiviralTagsP2A-puroExpressionMammalianAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_PROX1_1+4
Plasmid#121177PurposeLentiviral construct for the expression of Cas9 protein and puromycin resistance from EFS promoter and two guide RNAs targeting for deletion PROX1 start codon sequence.DepositorInsertCas9-P2A-puro and U6 promoters driven expression of gRNAs
UseCRISPR and LentiviralTagsP2A-puroExpressionMammalianAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDonor_mU6
Plasmid#69350PurposesgRNA scaffold and mouse U6 promoterDepositorInsertmU6 promoter and sgRNA scaffold flanked by BbsI sites
UseCRISPRPromotermU6 promoterAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX458-Dual-Guide-Donor-Cas9-H2B-mCherry
Plasmid#175570PurposeDonor shuttle plasmid to enable ligation of a second U6-GuideRNA casssette into any pX458 family backbone via digestion of both plasmids with XbaI and KpnI.DepositorTypeEmpty backboneUseCRISPRMutationXbaI site added upstream of U6 promotor. G to C …Available SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
phU6-gRNA
Plasmid#53188PurposeExpresses the S. pyogenes sgRNA from the human U6 promoterDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterhuman U6Available SinceJune 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pmU6-gRNA
Plasmid#53187PurposeExpresses the S. pyogenes sgRNA from the mouse U6 promoterDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromotermouse U6Available SinceJune 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-NS
Plasmid#149545PurposeExpression of single pegRNA under control of Drosophila U6:3 promoter. NS stands for "No Scaffold". Can be used to generate transgenic flies with vermillion+ selection.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterU6Available SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-U6insert-EF1puro
Plasmid#104537PurposeA piggybac vector with puromycin resistance and a U6 promoter that allows cloning of guide RNAsDepositorTypeEmpty backboneUseCRISPR, Mouse Targeting, and Synthetic Biology ; …ExpressionMammalianPromoterU6Available SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCFD5-NS
Plasmid#149546PurposeExpression of pegRNA(s) and sgRNA(s) under control of Drosophila U6:3 promoter. NS stands for "No Scaffold". Can be used to generate transgenic flies with vermillion+ selection.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterU6Available SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBC2102-reci
Plasmid#117171PurposeU6-sgRNA-EFS-Cas9-T2A-mCherry-P2A-Hygro; wtCas9 without NLSDepositorInsertreci_wtCas9 without NLS
UseLentiviralPromoterU6 PromoterAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
PTG
Plasmid#127198PurposeSingle template U6 promoter minimal size plasmidDepositorTypeEmpty backboneUseEmpty sgrna plasmidExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-RB1
Plasmid#87836PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive expression of an sgRNA targeting human RB1.DepositorInsertsgRB1 (RB1 Human)
UseCRISPR and Lentiviral; Doxycycline inducible; egf…ExpressionMammalianPromoterTight TRE promoter and U6Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-hSpCas9-pAc
Plasmid#162163PurposeExpresses hSpCas9-T2A-pAc (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter); puromycin selectableDepositorInsertshSpCas9
sgRNA
UseCRISPRTagsT2A-pAcExpressionInsectPromoterAe. aegypti PUb and Ae. aegypti U6Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only