We narrowed to 1,485 results for: U6 promoter
-
Plasmid#210212PurposeAn empty gRNA expression vector to clone U6 promoter driven sgRNAs with gRNA scaffold and with co-expression of DsRed. sgRNA can be cloned by Golden Gate Assembly or restriction digestion using BbsI.DepositorTypeEmpty backboneExpressionBacterial and MammalianPromoterU6Available SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only
-
PB-U6insert-EF1puro
Plasmid#104537PurposeA piggybac vector with puromycin resistance and a U6 promoter that allows cloning of guide RNAsDepositorTypeEmpty backboneUseCRISPR, Mouse Targeting, and Synthetic Biology ; …ExpressionMammalianPromoterU6Available SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-NS
Plasmid#149545PurposeExpression of single pegRNA under control of Drosophila U6:3 promoter. NS stands for "No Scaffold". Can be used to generate transgenic flies with vermillion+ selection.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterU6Available SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFD5-NS
Plasmid#149546PurposeExpression of pegRNA(s) and sgRNA(s) under control of Drosophila U6:3 promoter. NS stands for "No Scaffold". Can be used to generate transgenic flies with vermillion+ selection.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterU6Available SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBC2102-reci
Plasmid#117171PurposeU6-sgRNA-EFS-Cas9-T2A-mCherry-P2A-Hygro; wtCas9 without NLSDepositorInsertreci_wtCas9 without NLS
UseLentiviralPromoterU6 PromoterAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
PTG
Plasmid#127198PurposeSingle template U6 promoter minimal size plasmidDepositorTypeEmpty backboneUseEmpty sgrna plasmidExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-RB1
Plasmid#87836PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive expression of an sgRNA targeting human RB1.DepositorInsertsgRB1 (RB1 Human)
UseCRISPR and Lentiviral; Doxycycline inducible; egf…ExpressionMammalianPromoterTight TRE promoter and U6Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shMcu-1
Plasmid#181868PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shMcu-2
Plasmid#181867PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
LMP FFB
Plasmid#89491PurposeFirefly hairpinDepositorInsertFirefly luciferase hairpin, clone B
UseMouse Targeting and RetroviralExpressionMammalianPromoterU6 (The GFP-Puro is from a PGK promoter; the shRN…Available SinceMay 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA:NbCysP6
Plasmid#223217PurposeExpresses an sgRNA targeting the NbCysP6 gene in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbCysP6 sgRNA
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantPromoterArabidopsis U6 promoterAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mPCSK9)
Plasmid#170122PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse PCSK9 mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Pcsk9 Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mIDUA)
Plasmid#170123PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse IDUA mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Idua Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-CS-154
Plasmid#166230Purposelenti-U6-gRNA::CMVp-nCas9-PmCDA1-UGI-2A-mCherryDepositorInsertsU6-gRNA EGFP targetting
nCas9-PmCDA1-UGI-2A-mCherry
UseCRISPR and LentiviralPromoterCMV promoter and Human U6Available SinceDec. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ08-pAAVsc.U6-tracrRNA
Plasmid#211816PurposeAAV vector expressing tracrRNA under U6 promoterDepositorInsertU6-tracrRNA
UseAAVExpressionMammalianPromoterU6Available SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6:3-tevopreq1
Plasmid#190909PurposeExpression of single epegRNA under control of Drosophila U6:3 promoter. Can be used to generate transgenic flies with vermillion+ selection.DepositorInsertEmpty Backbone
UseCRISPRExpressionInsectAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pChimera
Plasmid#61476PurposeVector for conventional cloning that contains AtU6-26 promoter and sgRNA backboneDepositorInsertU6-26:sgRNA
UseCRISPRExpressionPlantPromoterU6-26Available SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAC-U63-gRNA2.1
Plasmid#170512PurposegRNA cloning vector containing a U6:3 promoter and a gRNA2.1 scaffold.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterU6:3Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6_(Gluc)_INT(GenPurpClon)
Plasmid#68433PurposeGeneral Purpose cloning vector for "INT"-like constructs under U6-promoter expression.DepositorInsertINT construct
UseCRISPR; Cloning vector for generating int-like co…ExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only