We narrowed to 24,790 results for: Spr
-
Plasmid#192682PurposeLentiviral expression of multi gRNAs targeting hASCL1 promoter to activate human ASCL1 transcriptionDepositorInsertHuman ASCL1 activating gRNAs #1,2,3 (ASCL1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97308PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
hA3A-BE3 (pRZ215)
Plasmid#131314PurposeCAG promoter expression plasmid for hA3A-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP.DepositorInserthA3A-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP
ExpressionMammalianPromoterCAGAvailable SinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGria3
Plasmid#124855PurposeMutagenesis of Gria3DepositorInsertGria3 (Gria3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187945PurposedCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertSpdCas9-tagRFPt-P2A-tagBFP
UseSynthetic Biology; PiggybacTagsNLS, NLS + HA-tag, P2A, tagBFP, and tagRFPtExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJSC129 - Bacterial expression plasmid for SpCas9-HF1, REC2 FRET variant
Plasmid#101211PurposeBacterial expression plasmid for SpCas9-HF1, REC2 FRET variantDepositorInsertSpCas9 variant C80S/C574S/E60C/D273C/N497A/R661A/Q695A/Q926A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, E60C, D273C, N497A, R661A, Q695A and…PromoterT7Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJSC057 - Bacterial expression plasmid for SpCas9∆REC3, REC2 FRET variant
Plasmid#101204PurposeBacterial expression plasmid for SpCas9∆REC3, REC2 FRET variantDepositorInsertSpCas9 variant C80S/C574S/E60C/D273C/M1–N497,GGS,V713–D1368
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, E60C, D273C, M1-N497, GGS, V713-D1368PromoterT7Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.S_mCherry-NLS
Plasmid#178224PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb MMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97311PurposeMMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb MMEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
SECURE BE4max(R33A) (pBM608)
Plasmid#140251PurposeCMV promoter expression plasmid for rAPOBEC1(R33A)-nCas9-UGI-UGI-P2A-EGFPDepositorInsertBE4max(R33A)
ExpressionMammalianMutationR33A in rAPOBEC1, D10A in Cas9PromoterCMVAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.NWS.Ollas_mCherry-NLS
Plasmid#178263PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.NWS.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 sgRNAscaffold 2.1 scRNA (GB1437)
Plasmid#160571PurposeVersion of SgRNA scaffold with the sequence 2.1 of Ms2 aptamer in the 3' end.DepositorInsertsgRNAscaffold 2.1 scRNA
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
hAID-BE3 (pRZ352)
Plasmid#131316PurposeCAG promoter expression plasmid for hAID-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP.DepositorInserthAID-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP
ExpressionMammalianPromoterCAGAvailable SinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-NLC-DHFR-SpCas9
Plasmid#124523PurposeExpresses SpCas9 fused to DHFR domains on both the N- and C- termini and an internal loop in mammalian cellsDepositorInsertNLC-DHFR-SpCas9
UseAAVTagsDestabilized domain of E.coli dihydrofolate reduc…ExpressionMammalianPromoterCbhAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTE4495
Plasmid#80338Purposemammalian expression MbCpf1 nuclease and Mb crRNADepositorInsertsMb crRNA
MbCpf1
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMV and human U6Available SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.HA.V5_mCherry-NLS
Plasmid#178283PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNWS.HA.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.VSVg.V5_mCherry-NLS
Plasmid#178236PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.VSVg.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.S.VSVg_mCherry-NLS
Plasmid#178234PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.S.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97312PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. Lenti backbone.DepositorInsertActb HMEJ donor
UseLentiviral and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(A)
Plasmid#85570PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.V5_mCherry-NLS
Plasmid#178242PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H3C2
Plasmid#207783PurposeDonor template for moxGFP-2A-Puro insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a moxGFP-Puro Cassette (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
JG1202: CAG-human dLbCpf1(D832A)-NLS-3xHA-P65
Plasmid#104566PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to p65 activation domainDepositorInsertdLbCpf1(D832A)-p65
Tags3x HA and NLSExpressionMammalianMutationD832APromoterCAGAvailable SinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97309PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HR donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMMACE DEST CMV SpCas9
Plasmid#206268PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes SpCas9 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertSpCas9
UseCRISPR; Recombinant baculovirus productionExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(B)
Plasmid#85571PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.VSVg_mCherry-NLS
Plasmid#178220PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.S_mCherry-NLS
Plasmid#178219PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.HSV_mCherry-NLS
Plasmid#178216PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.HSV and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.VSVg_mCherry-NLS
Plasmid#178214PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.S_mCherry-NLS
Plasmid#178213PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.HSV_mCherry-NLS
Plasmid#178210PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.HSV and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY152
Plasmid#130950Purposedcas9 generator and reporter circuit (PpspA-2G6 with sfgfp::ASV)DepositorInsertsdcas9
tetR
sfgfp
UseSynthetic BiologyTagsASV tagExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterPpspA-2G6 and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-sTagRFP-TUBA1B
Plasmid#207768PurposeDonor template for Blast-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Blast-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.Ollas.S_mCherry-NLS
Plasmid#178279PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNWS.Ollas.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.S.V5_mCherry-NLS
Plasmid#178278PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.S.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.Ollas.V5_mCherry-NLS
Plasmid#178277PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.Ollas.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.NWS.S_mCherry-NLS
Plasmid#178273PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.NWS.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgMAPKAP1_1
Plasmid#124912PurposeTargeting human MAPKAP1 (SIN1) gene by CRISPR-Cas9DepositorInsertMAPKAP1 (MAPKAP1 Human)
UseCRISPR and LentiviralAvailable SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-PE VQR
Plasmid#162797PurposeAll-in-one prime editor piggyBac transposon, VQR variantDepositorInsertSpCas9_H840A_VQR-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsSV40 NLSExpressionMammalianMutationD1135V, R1335Q, T1337RPromoterCAGAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb NHEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97310PurposeNHEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb NHEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only