We narrowed to 43,360 results for: Ina;
-
Plasmid#114475PurposeMammalian Expression Plasmid of anti-PARIS/ZNF746 (Human). Derived from hybridoma N196/16.DepositorInsertanti-PARIS/ZNF746 (Homo sapiens) recombinant mouse monoclonal antibody (ZNF746 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pABD823
Plasmid#67911PurposeProtein interaction with yeast two hybrid assay of CTG10 in yeast, Saccharomyces cerevisiaeDepositorInsertCold temperature germinating 10 (CTG10)
TagsGAL4 DNA binding domain (148 amino acids)ExpressionYeastPromoterpADH1 (alcohol dehydrogenase 1 promoter)Available SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pABD933
Plasmid#67917PurposeEntry clone made prior to studies of protein co-localization of CTG10 via fluorescent fusion after transient expression in plantaDepositorInsertCTG10
UseGateway cloning vectorAvailable SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
Anti-Malin [N85/18.1R]
Plasmid#114513PurposeMammalian Expression Plasmid of anti-Malin (Human). Derived from hybridoma N85/18.1.DepositorInsertanti-Malin (Homo sapiens) recombinant mouse monoclonal antibody (NHLRC1 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
Anti-Stonin-2 [N346/9R]
Plasmid#114484PurposeMammalian Expression Plasmid of anti-Stonin-2 (Human). Derived from hybridoma N346/9.DepositorInsertanti-Stonin-2 (Homo sapiens) recombinant mouse monoclonal antibody (STON2 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP134 [pRS406-YBR139Wp-YBR139W(S219,D415,H474A)-GFP-ADH1t]
Plasmid#106469PurposeExpresses Atg42/Ybr139w(S219,D415,H474A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(S219,D415,H474A)
TagsGFPExpressionBacterial and YeastMutationChanged Serine 219, Aspartate 415 and Histidine 4…PromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
Jam4.3-Fc-His
Plasmid#72082PurposeExpresses the extracellular region of the JAM-4, isoform 3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam3-Fc-His
Plasmid#72080PurposeExpresses the extracellular region of the JAM-3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lrrc4-AP-His
Plasmid#71958PurposeExpresses the extracellular region of the LRRC4 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam3-AP-His
Plasmid#71954PurposeExpresses the extracellular region of the JAM-3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam4.1-AP-His
Plasmid#71955PurposeExpresses the extracellular region of the JAM-4, isoform 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam4.3-AP-His
Plasmid#71956PurposeExpresses the extracellular region of the JAM-4, isoform 3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
RalA (G23V)(mature peptide)-pcw107-V5
Plasmid#64643Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
RalA (G23V)(mature peptide)-pcw107
Plasmid#64642Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pWZL-Neo-Myr-Flag-DEST
Plasmid#15300Purposea Gateway-compatible retroviral destination vector which adds a myristoylation sequence and a FLAG tag to each introduced ORFDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseRetroviralTagsFlag and MyrExpressionMammalianAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
AAV-GFP/Cre
Plasmid#49056PurposeAdeno-associated virus (AAV) encoding a green fluorescent protein/Cre recombinase (GFP/Cre) fusion protein.DepositorInsertCre
UseAAV, Cre/Lox, and Mouse TargetingTagsEGFP, Myc, and NLSExpressionMammalianPromoterCMVAvailable SinceFeb. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
lenti.DTR.GFP
Plasmid#201962PurposeLentiviral vector that expresses diptheria toxin receptor (DTR) C-terminally fused to EGFPDepositorInsertDiptheria Toxin Receptor
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1alphaAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ALK6 K231R
Plasmid#80884Purposemammalian expression of ALK6 K231RDepositorInsertALK6 (Bmpr1b Mouse)
TagsHAExpressionMammalianMutationK231R (kinase-deficient)PromoterCMVAvailable SinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
JAK2 (V617F)-pcw107-V5
Plasmid#64610Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA18.0 dCas9-VPR
Plasmid#138945PurposeFungal AMA1 backbone plasmid with sp-dCas9 fused to VP64-p65-Rta (VPR); ribozymes based sgRNA transcription unit; Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_dCas9m4_2xNLS-VPR; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-AAV.MaCPNS2
Plasmid#185137Purposenon-standard AAV2 rep-AAV-MaCPNS2 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-MaCPNS2 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-N1
Plasmid#125547PurposeGateway compatible N2H assay destination vector with N-terminus tagging of nanoluc fragment1DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment1 attached to n-terminus of Gatew…ExpressionBacterial and MammalianPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-C1
Plasmid#125549PurposeGateway compatible N2H assay destination vector with C-terminus tagging of nanoluc fragment1DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment1 attached to c-terminus of Gatew…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-C2
Plasmid#125559PurposeGateway compatible N2H assay destination vector with C-terminus tagging of nanoluc fragment2DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment2 attached to c-terminus of Gatew…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-N2
Plasmid#125548PurposeGateway compatible N2H assay destination vector with N-terminus tagging of nanoluc fragment2DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment2 attached to n-terminus of Gatew…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
Pan-Neurofascin (extracellular) scFv [A12/18]
Plasmid#190485PurposeMammalian Expression of Pan-Neurofascin (extracellular) scFV. Derived from hybridoma A12/18.DepositorInsertPan-Neurofascin (extracellular) (Rattus norvegicus) recombinant scFV (Nfasc Mouse)
TagsHA, Sortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-AAV.MaCPNS1
Plasmid#185136Purposenon-standard AAV2 rep-AAV-MaCPNS1 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-MaCPNS1 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pClneoMyc-LATS1
Plasmid#66851PurposeExpress Myc-tagged LATS1 in mammalian cellsDepositorInsertLATS1 (LATS1 Human)
TagsMycExpressionMammalianMutationP44L mutation in LATS1 compared to GenBank refere…PromoterCMVAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
Anti-GST [N100/13R ]
Plasmid#188214PurposeMammalian Expression Plasmid of anti-GST (Schistosoma japonicum). Derived from hybridoma N100/13DepositorInsertanti-GST (Schistosoma japonicum) recombinant mouse monoclonal antibody
ExpressionMammalianPromoterDual CMVAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-2dV-Camui (wt)
Plasmid#220366PurposeImproved FLIM sensor for CaMK2-alpha activation (mammalian expression, cytosol)DepositorInsertmVenus(Y145W)-mVenus(Y145W)-rat CaMK2 alpha(wt)-mEGFP(A206K) (Camk2a Synthetic, Rat)
TagsmEGFP(A206K) and mVenus(Y145W)-mVenus(Y145W)ExpressionMammalianPromoterCAGAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-VIP [L108/92R]
Plasmid#177453PurposeMammalian Expression Plasmid of anti-VIP (Human). Derived from hybridoma L108/92.DepositorInsertanti-VIP (Homo sapiens) recombinant mouse monoclonal antibody (VIP Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCrebbp#2/Cre
Plasmid#193210PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Crebbp geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS416-Gal4-dCas9-VP64
Plasmid#71128PurposeThis plasmid contains a Cas9 Activator for yeast. The activator is about 1.2-1.8 X more potent than just dCas9-VP64 fusion in yeast. It is on a single copy CEN/ARS plasmid with Ura marker, pRS416.DepositorInsertGal4-dCas9-VP64
TagsNLS n-terminal, N terminal Gal4 Activator domain,…ExpressionYeastPromoterTef1Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSPL3-hRPH3A_c.444Gwt
Plasmid#190476Purposeminigene assayDepositorInsertRPH3A (NM_014954.3) c.444 [exon 7 and part of surrounding introns only] (RPH3A Human)
ExpressionMammalianPromoterSV40Available SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-Neuroligin-3 [N110/15R]
Plasmid#225376PurposeMammalian Expression Plasmid of anti-Neuroligin-3 (Rat) IgG2a R-mAb. Derived from hybridoma N110/15.DepositorInsertAnti-Neuroligin-3 (Rattus norvegicus) recombinant (Mouse) monoclonal antibody. (Nlgn1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-Kv1.5 K+ channel [K7/45R]
Plasmid#140069PurposeMammalian Expression Plasmid of anti-Kv1.5 K+ channel (Rat). Derived from hybridoma K7/45.DepositorInsertanti-Kv1.5 K+ channel (Rat) recombinant mouse monoclonal antibody (Kcna5 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDEST26 Ago2
Plasmid#59904PurposeExpresses 6xHis-Ago2 (N-termi tag) in mammalian cellsDepositorAvailable SinceMay 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
Anti-VAChT [N425/45]
Plasmid#190326PurposeMammalian Expression Plasmid of anti-VAChT (Rat). Derived from hybridoma N425/45.DepositorInsertanti-VAChT (Rattus norvegicus) recombinant Mouse monoclonal antibody (Slc18a3 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-EDA in pMAX
Plasmid#120402Purposeenables eukaryotic expression of human EDA (or EIIIA) containing fibronectin based on plasma fibronectin sequenceDepositorAvailable SinceJuly 23, 2019AvailabilityAcademic Institutions and Nonprofits only