We narrowed to 21,452 results for: SPR
-
Plasmid#166097PurposeGal inducible expression of dCas9-FokIDepositorInsertdCas9-FokI
UseCRISPRExpressionYeastMutationspCas9-D10A, H840APromoterGal-inducibleAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
KG#865
Plasmid#110912PurposeCoding sequence for attaching the Auxin Inducible Degron to the C-terminus of a protein followed by a 5X Myc tag with spacersDepositorInsertAuxin Inducible Degron-5X Myc-Spacers for C-terminal attachment
ExpressionBacterialAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBzCas13b-gRNA-1
Plasmid#164858PurposeConstitutive expression of single-spacer CRISPR array with spacer #1 targeting deGFP mRNA for BzCas13b in bacteria.DepositorInsertBzCas13b-gRNA-1
ExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLsCas13a-gRNA-NT
Plasmid#164857PurposeConstitutive expression of single-spacer CRISPR array with non-targeting spacer for LsCas13a in bacteria.DepositorInsertLsCas13a-gRNA-NT
ExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHX_gRNA_hPAX7_6-9S
Plasmid#160453PurposesgRNA targeting human PAX7 3' UTR with 17bp spacerDepositorInsertgRNA_hPAX7_6-9S
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-RNF169UBD
Plasmid#119006PurposeMammalian expression of the human RNF169 Ubiquitin binding domain and BFPDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Topo_SpCas9.tracr_AsCas12a.DR
Plasmid#155050PurposeTOPO vector for the cloning of _the SpCas9 tracrRNA - AsCas12a Direct Repeat (DR) fragment into the pLCHKO hgRNA vectorDepositorInsertSpCas9 tracrRNA and AsCas12a Direct Repeat (DR)
UseCRISPRAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Topo_SpCas9.tracr_LbCas12a.DR
Plasmid#155049PurposeTOPO vector for the cloning of _the SpCas9 tracrRNA - LbCas12a Direct Repeat (DR) fragment into the pLCHKO hgRNA vectorDepositorInsertSpCas9 tracrRNA and LbCas12a Direct Repeat (DR)
UseCRISPRAvailable SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1820
Plasmid#154321PurposeMulti-cassette for SapTrapDepositorInsertGFP^SEC (LoxP)^AID*::3xFLAG
UseCRISPR and Cre/LoxExpressionWormAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMG
Plasmid#138264PurposeYeast intergration vector for integration of dual reporter system at the URA3 locus. Dual reporter system contains constitutive mCherry and constitutive eGFP flanked by iCas9 sites.DepositorInsertseGFP flanked by iCas9 sites
mCherry
UseCRISPRExpressionYeastPromoterTef1Available SinceMarch 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFH85
Plasmid#128198Purposeclassic sgRNA backbone for SpCas9, combine with TaU3 promoter module (pFH33)DepositorInsertclassic sgRNA backbone for SpCas9, combine with TaU3 promoter module (pFH33)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH86
Plasmid#128199Purposeimproved sgRNA backbone for SpCas9, combine with TaU3 promoter module (pFH33)DepositorInsertimproved sgRNA backbone for SpCas9, combine with TaU3 promoter module (pFH33)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgWRN1
Plasmid#125771Purposeconstitutive expression of a guide RNA targeting human WRNDepositorInsertsgWRN1 (WRN Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgWRN2
Plasmid#125772Purposeconstitutive expression of a guide RNA targeting human WRNDepositorInsertsgWRN2 (WRN Human)
UseCRISPRAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330.Pten.b
Plasmid#66588PurposesgRNA for Pten deletionDepositorInsertPten deletion (Pten Mouse)
ExpressionMammalianAvailable SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti-A3An-LRG2.1T
Plasmid#253343PurposeExpresses the N-terminal fragment of a rapamycin-inducible split A3A cytosine base editor together with an sgRNA expression cassette for in vivo base editingDepositorInsertA3An
UseCRISPR and LentiviralTagsmyc-A3An-FRBPromoterEFSAvailable SinceApril 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pH-EF1α-DualPE
Plasmid#236417PurposeFor plant prime editing including large DNA fragment editing in Solanum lycopersicum or other dicotyledonsDepositorInsertEF1α promoter
UseCRISPRExpressionPlantAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-epegRNA-SV40-mCherry
Plasmid#240538PurposeLentiviral backbone plasmid to insert epegRNAs (tevopreq1) of interest with mCherry. The cloning site is BsmBI.DepositorInsertepegRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21a-TEX264_wt-His6
Plasmid#220214PurposeBacterial expression of wild type TEX264, C-terminal His6 tagDepositorAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-GFP
Plasmid#200068PurposeFor the knock down of GFP with an astrocyte specific mCherry expressionDepositorInsertU6-sgRNA-GFP
UseAAV, CRISPR, and Mouse TargetingTagsGfaABC1D-mCherryPromoterU6, GfaABC1DAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-747_CD19-28z_CAR_TFAP4
Plasmid#207489PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertTFAP4, CD19-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_K700E_hSF3B1
Plasmid#176591PurposeAdenoviral construct to change K to E at 700th amino acid (K700E) in human SF3B1DepositorInsertSF3B1 (SF3B1 Human)
UseAAVAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-LbCas12a-Plus-mCherry
Plasmid#191230PurposeTo express the LbCas12a nuclease variant "LbCas12a-Plus" that enhanced the editing activity and specificityDepositorInsertLbCas12a-Plus-P2A-mCherry
UseCRISPRMutationD156R, R883K, R887AAvailable SinceAug. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d-sgCiCh2-2
Plasmid#202444PurposeExpression of a CRISPRi control sgRNA that cuts an intergenic region on chromosome 2DepositorInsertChromosome 2 gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnxABE-flgn
Plasmid#187932PurposeA-to-G base editorDepositorInsertecTadA(8e)-nxCas9 (D10A)
UseCRISPRExpressionBacterialAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKSB- 3xP3-YFPsv40 GGGG AAGA
Plasmid#174530Purpose3xP3-YFP fluorescence marker cassette for gene knock-in in mosquitoesDepositorInsert3xP3-YFP BsaI cassette
ExpressionInsectPromoter3xP3Available SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKSB- 3xP3-GFPsv40 GGGG AAGA
Plasmid#174531Purpose3xP3-GFP fluorescence marker cassette for gene knock-in in mosquitoesDepositorInsert3xP3-GFP BsaI cassette
ExpressionInsectPromoter3xP3Available SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKSB- 3xP3-mTurqSV40 GGGG AAGA
Plasmid#174533Purpose3xP3-mTurquoise fluorescence marker cassette for gene knock-in in mosquitoesDepositorInsert3xP3-mTurquoise BsaI cassette
ExpressionInsectPromoter3xP3Available SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
px459-AMBRA1 #3
Plasmid#172606PurposeExpresses gRNA #3 against AMBRA1 and Cas9 from S. pyogenes with 2A-PuroDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS8: pTns(AvCAST)
Plasmid#168141PurposeInducible expression of AvCAST TnsA, TnsB, TnsC, TniQ and TnsD proteins.DepositorInsertsAvCAST Tns proteins (TnsA, TnsB, TnsC and TniQ)
AvTnsD
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ269A2
Plasmid#164714PurposeGateway entry clone (attL1 & attR5) rAPOBEC1-CBE_V04 for C-T base editingDepositorInsertrAPOBEC1-zCas9(D10A)-UGI-T2A-MS2-UGI
UseCRISPR; Gateway compatible rapobec1-cbe_v04 entry…ExpressionPlantAvailable SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ269C2
Plasmid#164716PurposeGateway entry clone (attL1 & attR5) hAID-CBE_V04 for C-T base editingDepositorInserthAID-zCas9(D10A)-UGI-T2A-MS2-UGI
UseCRISPR; Gateway compatible haid-cbe_v04 entry clo…ExpressionPlantAvailable SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ269D
Plasmid#164717PurposeGateway entry clone (attL1 & attR5) PmCDA1-CBE_V04 for C-T base editingDepositorInsertzCas9(D10A)-PmCDA1-UGI-T2A-MS2-UGI)
UseCRISPR; Gateway compatible pmcda1-cbe_v04 entry c…ExpressionPlantAvailable SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJW1821
Plasmid#163092PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsertmScarlet^SEC (Lox511I)^::3xMyc
UseCRISPR and Cre/LoxExpressionWormAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJW1850
Plasmid#154328PurposesgRNA Target Vector for CRISPRDepositorInsertttTi5605 site targeting sgRNA (F+E) with K09B11.2 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-EAMP
Plasmid#138265PurposemCherry acceptor plasmid with iCas9 target site upstream of mCherry to be used in plasmid to plasmid integration reporter assay.DepositorInsertiCas9 target-mCherry
UseCRISPRExpressionMammalianPromoterEF1a-HTLVAvailable SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hU6-mU6-Cre2GO
Plasmid#136907PurposeLentivirus for base editing activatable Cre recombinase expression in mammalian cells. All in one vector with sgCre2GO.DepositorInsertBlasCyGO
UseLentiviralMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pC026 - PpCas13a from Paludibacter propionicigenes WB4
Plasmid#91916PurposeExpresses PpCas13a for bacterial expression and contains backbone for spacer cloningDepositorInsertPpCas13a and guide expression cassette
ExpressionBacterialAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only