We narrowed to 15,270 results for: grn
-
Plasmid#182143PurposeTo insert attP attachment site at AAVS1 in human cells via twinPEDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertA3786c-attP pegRNA
ExpressionMammalianPromoterhU6Available sinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA-BFP
Plasmid#107722PurposeFor expression of sgRNA from the U6 promoter with BFP expression simultaneouslyDepositorTypeEmpty backboneUseCRISPRAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-AtU3b/LacZ
Plasmid#66199Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterAtU3bAvailable sinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLH-sgRNA-Sirius-4X(MS2-PP7)
Plasmid#121941PurposeCRISPR-Sirius plasmidDepositorInsertsgRNA-Sirius-4X(MS2-PP7)
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterhuman U6 promoterAvailable sinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHEE2E-TRI
Plasmid#71288PurposeEgg cell-specific promoter-controlled expression 3×FLAG-NLS-zCas9-NLS and two sgRNAs targeting three genes: ETC2, TRY, and CPCDepositorInsertssgRNA targeting TRY and CPC genes
sgRNA targeting ETC2 gene
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available sinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
SS9_RNA
Plasmid#71656PurposeSS9-targeting gRNA for co-transformation with pSS9DepositorPublicationInsertSS9 gRNA
UseCRISPRExpressionBacterialPromoterJ23119Available sinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJR103
Plasmid#187242PurposeLentiviral sgRNA vector with mU6 sgRNA promoter, CR1 constant region, and UCOE EF1alpha driving PURO-BFP marker expressionDepositorInsertLentiviral sgRNA vector with mU6 sgRNA promoter, CR1 constant region, and UCOE EF1alpha driving PURO-BFP marker expression
UseLentiviralAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMZ374
Plasmid#59896PurposeCombination adh1:cas9/rrk1:sgRNA for CRISPR genome editing in fission yeast: Empty sgRNA target (CspCI placeholder) (see comments).DepositorInsertsCas9
rrk1:sgRNA
UseCRISPRExpressionYeastMutationSilent muation of the CspCI sitePromoteradh1 and rrk1Available sinceOct. 29, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHAGE-EFS-N22p-3XRFPnls
Plasmid#75387PurposeN22p-3XRFPnlsDepositorInsertN22p
UseLentiviralTags3XmCherryExpressionMammalianPromoterEFSAvailable sinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
BRCA1 A10.2 gRNA
Plasmid#90549Purpose3rd generation lentiviral gRNA plasmid targeting human BRCA1DepositorInsertBRCA1 (Guide Designation A10.2)
UseCRISPR and LentiviralPromoterU6Available sinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lentiCRISPR - CTRL sgRNA
Plasmid#70662PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a non-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorPublicationInsertnon-targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable sinceOct. 13, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX462-hPRKAA2-gRNA_A
Plasmid#74376PurposegRNA_A to knockout human AMPK alpha 2 using Cas9n.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman AMPK alpha 2 exon1 gRNA (PRKAA2 Human)
UseCRISPRPromoterU6Available sinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330-EN479
Plasmid#86234PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse Rosa26 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertspCas9-nickase and sgRNA against mouse rosa26 locus
UseMouse TargetingExpressionMammalianAvailable sinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
U6-sgRNA(MS2)_EF1a-MS2-P65-HSF1
Plasmid#92120PurposeExpression plasmid for both MS2-P65-HSF1 activator helper complex and sgRNA with two MS2 loops at tetraloop and stemloop 2 contains BsaI sites for insertion of spacer sequences.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMS2-P65-HSF1 (HSF1 Human, Synthetic)
UseCRISPRExpressionMammalianPromoterEF1aAvailable sinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-AsCas12f1
Plasmid#171614PurposeAsCas12f1-based Human cell genome editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAsCas12f1 and sgRNA_v1
ExpressionMammalianAvailable sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
SGEP
Plasmid#111170PurposemiR-E (miR-30 variant)-based RNAiDepositorInsertmiR-E (miR-30 variant)
UseLentiviralMutationWTPromoterSFFVAvailable sinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pWS082
Plasmid#90516PurposesgRNA entry vectorDepositorInsertYeast sgRNA expression vector
UseCRISPR; Yeast gap repairExpressionYeastAvailable sinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
OpenCRISPR-1 sgRNA-16nt stem
Plasmid#221566PurposeExpress OpenCRISPR-1 sgRNA (16nt stem loop) in human cells using a U6 promoter. Plasmid also encodes a CMV-driven GFP reporter.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertOpenCRISPR-1 sgRNA 16nt stem loop
ExpressionMammalianPromoterU6Available sinceAug. 28, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCas9/VRQR-sgRNA (BbsI)
Plasmid#129725PurposeExpressing SpCas9/VRQR mutant and sgRNA for target sequence with NGA PAMDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by