170,794 results
-
Plasmid#247938PurposeExpression of human LONP1 with methionine 115 as its first residue (mature mitochondrial-matrix localized form) and Walker B mutant (E591A)DepositorInsertLONP1 (LONP1 Human)
Tags6xHisExpressionBacterialMutationencodes aa 115-959, with E591APromoterT7Available SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+-tdmito-HyPerFLEX
Plasmid#217567PurposeMammalian expression HyPerFLEX targeted to the mitochondriaDepositorInserttdmito-HyPerFLEX
ExpressionMammalianPromoterCMV IE94Available SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
TPC2-GCaMP6s
Plasmid#240465PurposeLysosomal channel with a high-affinity GECI fused to the C-terminusDepositorAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.HaloTag
Plasmid#244094PurposeCytosolic expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.H348H.HaloTag
Plasmid#244095PurposeCytosolic expression of green glucose sensor (high affinity) with non-responsive HaloTagDepositorInsertiGlucoSnFR2.H348H.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
NanoLuc-CBP Fusion Vector
Plasmid#238646PurposeExpress NanoLuc-CBP Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertCBP (CREBBP Human)
TagsNanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET BiBRET Vector, HaloTag-KRAS(G12C)_BRAF-NanoLuc
Plasmid#238566PurposeExpress HaloTag-KRAS(G12C)_BRAF-NanoLuc Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationG12CPromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET Assay Vector, ARAF-NanoLuc
Plasmid#236876PurposeExpress ARAF-NanoLuc(R) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertARAF (ARAF Human)
TagsNanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceSept. 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGY214
Plasmid#239805PurposeExpress EGFP and mRFP1 simultaneously in filamentous fungiDepositorInsertsEGFP
mRFP1
UseFungal expressionPromoterTef1INAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA_mIGg2a_Anti-DYKDDDDK [M2] v2
Plasmid#236293PurposeMammalian vector expressing Anti-DYKDDDDK [M2] variable region fused to mouse IgG2a heavy chain; to be used with pcDNA_mK-Anti_DYKDDDDK [M2] v2 light chain (Plasmid 236294) to make the antibody.DepositorInsertAnti-DYKDDDDK [M2] heavy chain variable region fused to mouse IgG2a heavy chain
TagsMouse IgG2a FcExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA_mK-Anti_DYKDDDDK [M2] v2
Plasmid#236294PurposeMammalian vector expressing Anti-DYKDDDDK [M2] variable region fused to mouse Kappa light chain; to be used with pcDNA_mIGg2a_Anti-DYKDDDDK [M2] v2 heavy chain (Plasmid 236293) to make the antibody.DepositorInsertAnti-DYKDDDDK [M2] light chain variable region fused to mouse kappa light chain
ExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGEX-4T-3-GST-Tev-Af1521(K35E/Y145R)-myc
Plasmid#196241PurposeN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site located between the GST tag and Af1521 and a myc tag on the C terminusDepositorInsertN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site between GST and Af1521 encoding a C-terminal myc tag
TagsGST tag and myc tagExpressionBacterialMutationamino acid 35 lysine is replaced with glutamic ac…Available SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
CBP (bd1)-NanoLuc Fusion Vector
Plasmid#236945PurposeExpress CBP (bd1)-NanoLuc(R) Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertCBP (CREBBP Human)
TagsNanoLuc (R)ExpressionMammalianMutationBromodomain 1PromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
MZB053
Plasmid#217835PurposeBacterial expression of human AP3B1 (1-677) and AP3M1 AP-3 core hemicomplexDepositorTagsGSTExpressionBacterialMutationRemoved residues 678-1094 from AP3B1Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-STIM1 WPRE
Plasmid#236234PurposeAAV expression of mouse STIM1 internally tagged with mEmeraldDepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBMN-SRF
Plasmid#232629PurposeLentiviral plasmid expressing human SRF.DepositorAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH941
Plasmid#230846PurposeEf1a-DivA-BE-T2A-GFP-wPREDepositorInsertDivA-BE
UseLentiviralExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA26x
Plasmid#190438PurposeEmpty pSEVA26x vector.DepositorArticleTypeEmpty backboneUseSynthetic BiologyAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
WNV NS2B-NS3 protease (catalytically active, self cleave); aliases: West Nile Virus NS2B-NS3 fusion protein
Plasmid#204795PurposeBacterial expression of a fusion of West Nile NS2B-NS3 proteinsDepositorInsertWest Nile NS2B-NS3 fusion
ExpressionBacterialAvailable SinceAug. 29, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJP_Ctrl10
Plasmid#219672PurposeContains PT3lacO promoter (regulated by blue light and LacI) controlling the expression of mCherry. LacI is constitutively produced by pR promoter.DepositorInsertsmCherry
lacI
PromoterPT3lacO and pRAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJP_Rep00
Plasmid#219677PurposeLight-inducible repressilator (modified from pLPT107). PT3lacO promoter controls the expression of TetR node.DepositorInsertPT3lacO
UseSynthetic BiologyPromoterPT3lacOAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
LAMTOR1-APEX2
Plasmid#215556PurposeStable, inducible expression in lysosomeDepositorInsertLAMTOR1-EGFP-Flag tag-APEX2-NES
UseLentiviralAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
FGF8-P2A-iCre
Plasmid#210800PurposeRecombinase reporter for FGF8 expressionDepositorInsertFGF8 (FGF8 Human)
UseCre/LoxTagsiCreExpressionMammalianPromoterendougeneous FGF8 promoterAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPRC5C-DuET
Plasmid#213297PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPRC5A-DuET
Plasmid#213295PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBla_1.2_EmrE_TMD4_3P_G90V_G97V
Plasmid#207847PurposeBLaTM-System; Antiparallel negativecontrol EmrE_TMD4_3P_G90V_G97V in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBla_1.2_EmrE_TMD4_3P
Plasmid#207846PurposeBLaTM-System; Antiparallel positive control EmrE_TMD4_3P in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBla_1.2_GpA_wt
Plasmid#207842PurposeBLaTM-System GpA wt positive control in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
CBLa_1.2_GpA_wt
Plasmid#207843PurposeBLaTM-System GpA wt positive control in CBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251_ Ptrc.x.tetO2::D-HicDH
Plasmid#185456PurposeCDS of D-HicDH codon optimized for expression in Synechocystis sp. PCC 6803 under the control of the synthetic promoter Ptrc.x.tetO2 and the RBS BBa_B0030 in pSEVA251 plasmid.DepositorInsertD-HicDH from Lactobacillus paracasei DSM 20008
ExpressionBacterialPromoterPtrc.x.tetO2Available SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF752
Plasmid#88486PurposeDonor Vector containing ZNF752 transcription factor, part of the Human TFome CollectionDepositorInsertZNF752 (ZFP3 Human)
UseGateway donor vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDZ114
Plasmid#159357PurposeExpresses sfYFP tagged with ssrA from the Pcin promoterDepositorInsertsfYFP
UseSynthetic BiologyPromoterPcinAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-HaloSFPQY527A
Plasmid#166949PurposeLentiviral plasmid expressing Halo-tagged SFPQ Y527A protein from the EF1a promoterDepositorAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
TetO-FUW-NICD
Plasmid#61540PurposeExpresses NOTCH-ICD in mammalian cellsDepositorInsertNOTCH-ICD (NOTCH1 Human)
UseLentiviralExpressionMammalianMutationNOTCH intracellular domain (aa1761-2555); A1943S…Available SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
SPLICS Mt-ER- Po Long P2A
Plasmid#164117PurposeDetect the long Peroxisomes-mitochondria-Endoplasmic reticulum contactDepositorInsertSplit GFP and YFP Mt-ER- Po Long P2A
ExpressionMammalianAvailable SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF6-Acly
Plasmid#70765PurposeExpresses mouse ATP-citrate lyase in mammalian cellsDepositorAvailable SinceNov. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
eGFP-proα2(I)-G610C
Plasmid#119827PurposeExpresses mouse Type I procollagen α2 chain (Col1a2) with Gly610Cys mutation and GFP between signal sequence and exon 6DepositorInsertType I procollagen α2 chain (Col1a2 Mouse)
TagseGFPExpressionMammalianMutationCol1a2 exons 2-5 replaced by fluorescent tag, Gly…PromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ142
Plasmid#69294PurposeGolden Gate recipient and Gateway entry vector; assembly of 2 gRNAsDepositorTypeEmpty backboneUseCRISPRAvailable SinceNov. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
VEE-EGFP-IRES-PuroR
Plasmid#242414PurposeSpectral unmixing: EGFP onlyDepositorInsertsEGFP
IRES-PuroR
UseSelf-amplifying rnaExpressionMammalianAvailable SinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits only