We narrowed to 13,867 results for: cas9
-
Plasmid#224789PurposeLPUtopia matching RMCE donor plasmid with mCherry-P2A-RfxCas13d Negative-Feedback circuit. Use BlastR for positive selection and HSV-TK for negative selection.DepositorInsertmCherry-P2A-RfxCas13d
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMV-d2iAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
px552-sg-gria1-HT
Plasmid#187652PurposeContains HaloTag to be inserted into the NTD of Gria1 (via HITI), single guide RNA to target Cas9 to Gria1 under control of the U6 promoter, and miRFP670 under control of human synapsin promoter.DepositorInsertsHaloTag donor sequence
miRFP670
UseAAV and CRISPRTagsN/AExpressionMammalianPromoterSynapsinAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
eA3Ai-max
Plasmid#207166PurposeExpress A3A with an N57G point mutation and an intron in a BE4max-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3A (APOBEC3A Human)
TagsCas9-UGI-UGI-NLS and NLSExpressionMammalianMutationN57GPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTij_sg_mmu_Med6_C_terminal
Plasmid#197869PurposeCRISPR/Cas9/sgRNA plasmid for cutting Med6 C terminal and building MED6-mEmerald/Halo knock-in mESCsDepositorAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-dora[B]_rescue_construct
Plasmid#190638PurposePuromycin-selectable expression of HA-tagged Dora[T295M] (CG34401) in Drosophila S2 cellsDepositorInsertDorado (CG34401 Fly)
Tags3xHAExpressionInsectMutationChanged threonine 295 to methioninePromoterActin-5cAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-dora[A]_rescue_construct
Plasmid#190640PurposePuromycin-selectable expression of HA-tagged truncated Dora (CG34401) in Drosophila S2 cellsDepositorInsertDorado (CG34401 Fly)
Tags3xHAExpressionInsectMutationTruncated to contain amino acids 1-945PromoterActin-5cAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_miR-290-295KO-gRNA3
Plasmid#172711PurposeCas9 with 5' gRNA for paired CRISPR KO of miR-290-295 clusterDepositorInsertmiR-290-295
UseCRISPRAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTOPO-col10a1-KI-donor
Plasmid#184874PurposeDonor template for knock-in of p2a-CreERT2 into the medaka col10a1 locus via CRISPR/Cas9-mediated homology directed repairDepositorInsertsCollagen10a1 5' homology arm
Collagen10a1 3' homology arm
p2a-CreERT2
Myosin light chain 2 promoter
eGFP
UseCRISPR and Cre/LoxAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-mNG-CfANLN
Plasmid#183837PurposeRepair template for the N-terminal tagging of anillin with mNeonGreen in canine cells using CRISPR/Cas9.DepositorInsertCanis familiaris ANLN homology arms with mNeonGreen-linker
UseCRISPR; Donor templateTagsmNeonGreen-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEGF-5’UTR
Plasmid#177260PurposeA knockout vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEgf
Plasmid#173700PurposeA knock-out vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-neo-dTgfa
Plasmid#173842PurposeA knockout vector for the dog Tgfa.DepositorInsertA gRNA targeting the dog Tgfa gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-puro-dEgfr
Plasmid#173844PurposeA knockout vector for the dog Egfr.DepositorInsertA gRNA targeting the dog Egfr gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
Bmpr2 gRNA#2
Plasmid#163389PurposeCas9-mediated knockout of Bmpr2 in mammalian cellsDepositorAvailable SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Bmpr2 gRNA#1
Plasmid#163388PurposeCas9-mediated knockout of Bmpr2 in mammalian cellsDepositorAvailable SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Bmpr2 gRNA#3
Plasmid#163390PurposeCas9-mediated knockout of Bmpr2 in mammalian cellsDepositorAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-uTEV1-SQSfl
Plasmid#171010PurposeHiLITR protease with full-length SQS targeting information (ER)DepositorInsertEGFP-uTEV1-SQS(FL)
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterpTRE-tight (TetOn)Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH2 #7
Plasmid#166102PurposeThis plasmid express a sgRNA that targets the IDH2 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH2-135 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH1 #4
Plasmid#166101PurposeThis plasmid express a sgRNA that targets the IDH1 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH1-67 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRWJB006
Plasmid#160113PurposeDestination vector expressing plant-codon-optimized Cas9 under 35S promoter (BamHI and NotI), with sgRNAs be shuffled in; seed coat specific red fluorescence for screening trangene freeDepositorTypeEmpty backboneUseCRISPRExpressionBacterial and PlantPromoter35SAvailable SinceFeb. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRWJB004
Plasmid#160112PurposeDestination vector expressing plant-codon-optimized Cas9 under UBQ10 promoter (BamHI and NotI), with gRNAs be shuffled in; seed coat specific red fluorescence for screening trangene free plants;DepositorTypeEmpty backboneUseCRISPRExpressionBacterial and PlantPromoterUBQ10Available SinceFeb. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJT174_GalL_A3A-Y130F-BE3
Plasmid#145123PurposeExpressing base editor A3A-Y130F-BE3 in yeast cellsDepositorInsertA3A(Y130F)-BE3
UseCRISPRExpressionYeastMutationA3A(Y130F); spCas9(D10A)PromoterGalLAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJT173_GalL_A3A-R128A-BE3
Plasmid#145122PurposeExpressing base editor A3A-R128A-BE3 in yeast cellsDepositorInsertA3A(R128A)-BE3
UseCRISPRExpressionYeastMutationA3A(R128A); spCas9(D10A)PromoterGalLAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJT113_GalL_cCDA1-xBE3
Plasmid#145079PurposeExpressing base editor cCDA1-xBE3 in yeast cellsDepositorInsertcCDA1-xBE3
UseCRISPRExpressionYeastMutationspCas9(D10A, A262T, R324L, S409I, E480K, E543D, M…PromoterGalLAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR V2 sgMTHFD1L_2
Plasmid#106317PurposeExpress Cas9 and sgRNA targeting MTHFD1LDepositorInsertsgRNA targeting MTHFD1L
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCK669
Plasmid#192638PurposeExpresses dxCas9-NG and MCP-SoxS(R93A/S101A) on p15A-CmRDepositorInsertsSp.pCas9-dxCas9-NG
BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPR and Synthetic BiologyMutationSoxS has R93A and S101A mutations and dxCas9-NG h…PromoterBBa_J23107 and Sp.pCas9Available SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCK668
Plasmid#192637PurposeExpresses dCas9-NG and MCP-SoxS(R93A/S101A) on p15A-CmRDepositorInsertsSp.pCas9-dCas9-NG
BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPR and Synthetic BiologyMutationSoxS has R93A and S101A mutations and dCas9-NG ha…PromoterBBa_J23107 and Sp.pCas9Available SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CABE-T1.17
Plasmid#193260PurposeExpression of CABE-T1.17 base editor in mammalian cells, CMV promoterDepositorInsertCABE-T1.17
ExpressionMammalianMutationD10A (Cas9), TadA mutations withinPromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CABE-T2.9
Plasmid#193264PurposeExpression of CABE-T2.9 base editor in mammalian cells, CMV promoterDepositorInsertCABE-T2.9
ExpressionMammalianMutationD10A (Cas9), TadA mutations withinPromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2GFP
Plasmid#82416Purpose3rd generation lentiviral vector expressing GFP alongside Cas9 and an sgRNA cloning siteDepositorInsertGFP
UseCRISPR and LentiviralPromoterEFS (P2A)Available SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
Orco-T2A-QF2-9xQUAS-GCaMP6f-3XP3-dsRed
Plasmid#157974PurposeTemplate plasmid for inserting GCaMP reporter into the Orco gene of Aedes aegypti with CRISPR/Cas9DepositorInsertOrco
ExpressionInsectAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPlatTET-gRNA2
Plasmid#82559PurposeAll in one vector which contains Cas9 peptide array (linker length: 22aa), antibody-sfGFP-TET1CD, and gRNA expression system.DepositorInsertdCas9-5xPlat2AflD-P2A-scFvGCN4sfGFPTET1CD
ExpressionMammalianAvailable SinceSept. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
ABE-NW1
Plasmid#240615PurposeAdenine base editor with narrowed editing windowDepositorInsertTadA8e(N108Q,M151C,Q154Y)-linker-nCas9 (D10A)
UseCRISPRExpressionMammalianMutationTadA8e(N108Q,M151C,Q154Y),Cas9 (D10A)Available SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR_DKO
Plasmid#183192PurposePlasmid with Cas9, two U6 promoters and two gRNA scaffolds that allows for inserting two gRNAs for combinatorial CRISPR Screen or double-knock-out (DKO) screenDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhU6, mU6Available SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pR26-CMVconst
Plasmid#127373PurposeAllows for constitutive gene expression from the murine ROSA26 safe harbor locus upon CRISPR/Cas9-mediated genomic insertion and stable selection.DepositorTypeEmpty backboneUseCRISPR and Mouse TargetingPromoterCMV enhancer/promoterAvailable SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pR26
Plasmid#127372PurposeAllows for doxycycline-inducible gene expression from the murine ROSA26 safe harbor locus upon CRISPR/Cas9-mediated genomic insertion and stable selection.DepositorTypeEmpty backboneUseCRISPR and Mouse TargetingPromotertight TRE promoterAvailable SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only