We narrowed to 1,494 results for: U6 promoter
-
Plasmid#190685PurposesgRNA targeting enhancer 3 of MYCDepositorInsertsgRNA targeting enhancer 3 of MYC
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianPromotermouse U6 promoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_Std_Dual_epegRNA_tevopreQ1
Plasmid#187457PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 T804N-G6 pegRNA with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmidDepositorInsertATP1A1 G6 T804N pegRNA (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE_Tubb3 GFP(Y39TAG) KI
Plasmid#182678PurposeExpression of spCas9, gRNA targeting the end of Tubb3 gene and donor GFP(Y39TAG). Can be used for amber codon suppression and click chemistry labeling of endogenous beta-3 tubulin in mammalian cells.DepositorExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
TKIT NFL gRNA1 gRNA2
Plasmid#182681PurposeExpression of spCas9, gRNA targeting intron 3 and gRNA targeting 3'UTR of the mouse Nefl gene. Can be used for the tagging of endogenous NFL via Targeted Knock-In with Two guides (TKIT) approach.DepositorInserttwo Nefl-targeting gRNAs, one targets intron 3 and the other 3'UTR of the Nefl gene (Nefl Mouse)
UseCRISPRExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-Tetra Loop-8A8G
Plasmid#157982PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (Tetra-8A8G)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_MTH17CL396
Plasmid#136656PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:MTH17CL396 chimera) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9:MTH17CL396 Chimera
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterCAG and hU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_TH1477
Plasmid#136655PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:TH1477 chimera) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9:TH1477 Chimera
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterCAG and hU6Available SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_LMG18311
Plasmid#136653PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:LMG18311 chimera) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD9:LMG18311 chimera
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterCAG and hU6Available SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2AmCherry-W
Plasmid#67977PurposeCRISPR gRNA expression vector with an improved scaffold and puro/mCherry markersDepositorInsertU6gRNA cassette, PGKpuro2AmCherry cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W
Plasmid#67974PurposeCRISPR gRNA expression vector with an improved scaffold and puro/BFP markersDepositorInsertU6gRNA cassette, PGKpuro2ABFP cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKBFP2AGFP-W
Plasmid#67979PurposeCas9 activity reporter (control) with BFP and GFP.DepositorInsertU6gRNA cassette, PGKBFP2AGFP cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2AmAG-W
Plasmid#67976PurposeCRISPR gRNA expression vector with an improved scaffold and puro/mAG markersDepositorInsertU6gRNA cassette, PGKpuro2AmAG cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2AZsG-W
Plasmid#67975PurposeCRISPR gRNA expression vector with an improved scaffold and puro/ZsG markersDepositorInsertU6gRNA cassette, PGKpuro2AZsG cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-mHbb-bh1_ gRNA_1-MS2-Puro
Plasmid#192681PurposeLentiviral expression of sgRNA targeting mHbb-bh1promoter to activate mouse Hbb-bh1 transcriptionDepositorInsertMouse Hbb-bh1 activating gRNA #1 (Hbb-bh1 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
PL6-CS-WR
Plasmid#122512Purposeconstruction for sgRNA transcription with Plasmodium falciparum U6 promotorDepositorTypeEmpty backboneUseCRISPRPromoterPfU6Available SinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330 p53
Plasmid#59910PurposepX330 backbone expressing sgRNA targeting p53 to edit mouse p53. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330 Pten
Plasmid#59909PurposepX330 backbone expressing sgRNA targeting Pten to edit mouse Pten. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJW1849
Plasmid#154327PurposesgRNA Target Vector for CRISPRDepositorInsertttTi4348 site targeting sgRNA (F+E) with K09B11.2 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBA950
Plasmid#122239PurposeCROP-seq vector optimized for sgRNA expression and CRISPRi activity. This vector expresses a eGFP-NT2 sgRNA with modified U6 promotor and sgRNA constant region.DepositorInsertBFP selectable marker, plus a modified mU6 promoter and sgRNA constant region for optimized CRISPRi activity
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330 Ctnnb1.1
Plasmid#59911PurposepX330 backbone expressing sgRNA targeting Ctnnb1 to edit mouse beta-Catenin. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g3)-PGKpuroBFP-W
Plasmid#211984PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g7-5)-PGKpuroBFP-W
Plasmid#211985PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-saCBE N-terminal
Plasmid#137182PurposeAAV genome: expresses the N-terminal of S. aureus v5 AAV-CBE from the Cbh promoter, U6-sgRNADepositorInsertv5 AAV-saCBE N-terminal
UseAAVMutationCas9 D10APromoterCbhAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-PuroR_BACH2-sgRNA8
Plasmid#71828PurposeExpression of dCas9-DNMT3A fusion with T2A-PuroR and specific sgRNA for targeted DNA methylation of BACH2 promoter in human cells; for use as a controlDepositorInsertBACH2-sgRNA8 (BACH2 Synthetic, S. pyogenes, Human)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterU6Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV_LP1B_St1Cas9_LMD-9_SpA_U6_sgRNA
Plasmid#110624PurposeA single vector AAV-Cas9 system containing a liver-specific promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNADepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
UseAAV, CRISPR, and Mouse TargetingTagsSV40 NLSExpressionMammalianPromoterLP1B and hU6Available SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-saCBE C-terminal
Plasmid#137183PurposeAAV genome: expresses the C-terminal of S. aureus v5 AAV-CBE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-saCBE C-terminal
UseAAVPromoterCbhAvailable SinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
B270 + SMARCAL1 sgSTOP
Plasmid#100717PurposeB270 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) in combination with ATP1A1 sgSTOPDepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI) and ATP1A1 (SMARCAL1 Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJW1838
Plasmid#154324PurposesgRNA Destination Vector for SapTrapDepositorInsertSapTrap sgRNA (F+E) vector, K09B11.2 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_PSMD1_sgRNA_5
Plasmid#74181Purposelentiviral vector expressing sgRNA targeting PSMD1DepositorInsertPSMD1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_PSMD1_sgRNA_1
Plasmid#74180Purposelentiviral vector expressing sgRNA targeting PSMD1DepositorInsertPSMD1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
B52 + CHEK2 sgSTOP
Plasmid#100712PurposeB52 plasmid expressing CHEK2 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting CHEK2 (cloned using BbsI) (CHEK2 Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-LmoCas6-p300
Plasmid#126486PurposeEncodes L.monocytogenes CRISPR Type I-B Cas6 with N-terminal fusion of Flag epitope and NLS and C-terminal fusion of NLS, human p300 HAT core (aa1048-1664), and Flag tag epitope driven by CMV promoterDepositorInsertLmoCas6-p300
UseCRISPRTagsFlag and Flag, NLSExpressionMammalianPromoterCMV and U6Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_EIF3D_sgRNA_1
Plasmid#74187Purposelentiviral vector expressing sgRNA targeting EIF3DDepositorInsertEIF3D sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
B52 + FANCM sgSTOP
Plasmid#100710PurposeB52 plasmid expressing FANCM sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting FANCM (cloned using BbsI) (FANCM Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJW1883
Plasmid#154331PurposesgRNA Target Vector for CRISPRDepositorInsertttTi5605 site targeting sgRNA (F+E) with R07E5.16 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_EIF3D_sgRNA_4
Plasmid#74188Purposelentiviral vector expressing sgRNA targeting EIF3DDepositorInsertEIF3D sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch2#2/Cre
Plasmid#193226PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch2 geneDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJW1850
Plasmid#154328PurposesgRNA Target Vector for CRISPRDepositorInsertttTi5605 site targeting sgRNA (F+E) with K09B11.2 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1882
Plasmid#154330PurposesgRNA Target Vector for CRISPRDepositorInsertttTi4348 site targeting sgRNA (F+E) with R07E5.16 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only