We narrowed to 2,903 results for: BFP
-
Plasmid#122659PurposeExpresses sgRNA for telomere repeats with fluorescent indicator BFP and puromycin selection markerDepositorInsertBFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRS416-BXG-altTAG
Plasmid#158146PurposeDual fluorescent protein reporter (BFP-GFP) for ncAA incorporation (TAG construct)DepositorInsertBFP-GFP fragment (w/ TAG codon)
ExpressionYeastPromoterGAL1-10Available SinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS416-BXG
Plasmid#158145PurposeDual fluorescent protein reporter (BFP-GFP) for ncAA incorporation (TAG construct)DepositorInsertBFP-GFP fragment (w/ TAG codon)
ExpressionYeastPromoterGAL1-10Available SinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS416-BYG
Plasmid#158144PurposeDual fluorescent protein reporter (BFP-GFP) for ncAA incorporation (wild-type construct)DepositorInsertBFP-GFP fragment (wild-type)
ExpressionYeastPromoterGAL1-10Available SinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCR1068
Plasmid#111092PurposeBFP/puromycin marked gRNA vector. Contains sgRNA against GFP/BFP N-terminus.DepositorTypeEmpty backboneUseLentiviralMutationBlpI site disruptedAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
GWF148
Plasmid#133617PurposeGNCR1-BFP-CAAXDepositorInsertGNCR1-BFP-CAAX
ExpressionMammalianAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
GWF135
Plasmid#133614PurposeANR-ANR-BFP-CAAXDepositorInsertANR-ANR-BFP-CAAX
ExpressionMammalianAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCTCON2-BXG-altTAG
Plasmid#158132PurposeDual fluorescent protein reporter (BFP-GFP) for ncAA incorporation (TAG construct)DepositorInsertBFP-GFP fragment
ExpressionYeastMutationCloned in a TAG codon at the first serine residue…PromoterGAL1-10Available SinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCTCON2-BXG-altTAG2
Plasmid#158134PurposeDual fluorescent protein reporter (BFP-GFP) for ncAA incorporation (TAG construct)DepositorInsertBFP-GFP fragment
ExpressionYeastMutationCloned in a TAG codon at the second serine residu…PromoterGAL1-10Available SinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCTCON2-BXG-altTAG3
Plasmid#158136PurposeDual fluorescent protein reporter (BFP-GFP) for ncAA incorporation (TAG construct)DepositorInsertBFP-GFP fragment
ExpressionYeastMutationCloned in a TAG codon at the third alanine residu…PromoterGAL1-10Available SinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCTCON2-BXG-altTAG4
Plasmid#158137PurposeDual fluorescent protein reporter (BFP-GFP) for ncAA incorporation (TAG construct)DepositorInsertBFP-GFP fragment
ExpressionYeastMutationCloned in a TAG codon at the third serine residue…PromoterGAL1-10Available SinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
p101_CRISPRai_PiggyBac
Plasmid#213777PurposeExpresses Tet-On inducible CRISPRai orthogonal system with VPR-dSaCas9, dSpCas9-KRAB-BFP, zeocin resistance gene, and Tet-On transactivator. PiggyBac vector.DepositorInsertsVPR-dSaCas9
dSpCas9-KRAB-BFP
zeocin
Tet-On transactivator
UseCRISPRPromoterEF1a (EF-1-alpha intron a) and Tet_On_TREAvailable SinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-RT001-LVB
Plasmid#163381PurposeSecond generation lentiviral vector to express anti-GFP(LaG17) module in the G-baToN systemDepositorInsertLaG17-VEEGFRtm-BFP (LVB)
UseLentiviralTagsBFPExpressionMammalianPromoterEF1AAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVX-RT004-LaG30VB
Plasmid#163384Purpose2nd generation lentiviral vector to express anti-GFP(LaG30) module in the G-baToN systemDepositorInsertLaG30-VEEGFRtm-BFP (LaG30VB)
UseLentiviralTagsBFPExpressionBacterial and MammalianPromoterEF1aAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVX-RT007-GCN4scFV-VB
Plasmid#163387Purpose2nd generation lentiviral vector to express anti-GCN4 module in the G-baToN systemDepositorInsertantiGCN4scFV-VEEGFRtm-BFP (GCN4scFV-VB)
UseLentiviralTagsBFPExpressionBacterial and MammalianPromoterEF1aAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
GWF297
Plasmid#133612PurposeTET3G-2xMS2(wt+f6), NLS-MCP-ANR-ANR-P2a-BFPDepositorInsertTET3G-2xMS2(wt+f6), MCP-ANR-ANR, BFP
ExpressionMammalianAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAT024
Plasmid#171636PurposePlasmid containing a U6 promoter expressing a spyCas9 sgRNA targeting BFP and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-BFP
mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and U6Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCTCON2-BXG-2TAG
Plasmid#158138PurposeDual fluorescent protein reporter (BFP-GFP) for ncAA incorporation (2 TAG construct)DepositorInsertBFP-GFP fragment
ExpressionYeastMutationCloned in a TAG codon at the first serine residue…PromoterGAL1-10Available SinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
GWF303
Plasmid#133611PurposeCD95-1-2xPP7, NLS-PCP-DNCR2-P2a-BFPDepositorInsertCD95-1-2xPP7, PCP-DNCR2, BFP
ExpressionMammalianAvailable SinceNov. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
GWF314
Plasmid#133610PurposeCXCR4-com, NLS-com-GNCR1-P2a-BFPDepositorInsertCXCR4-6-com, com-GNCR1, BFP
ExpressionMammalianAvailable SinceNov. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
GWF243
Plasmid#133608PurposeNS3a-CAAX-(IRES)-EGFP-DNCR2-TIAM-P2a-BFP-GNCR1-LARGDepositorInsertNS3a-CAAX, EGFP-DNCR2-TIAM, BFP-GNCR1-LARG
ExpressionMammalianAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
TC1405
Plasmid#164877PurposeBFP-preSTOP-GFP reporterDepositorInsertBFP-preSTOP-GFP
ExpressionMammalianAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-Azurite
Plasmid#36086Purpose3rd generation lentiviral plasmidDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 1, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMTL5
Plasmid#127967PurposeDHFR-degron controlled expression of KRAB-dCas9-BFP-KRAB from the AAVS1 locusDepositorInsertAAVS1-CAG-DHFR-KRAB-dCas9-BFP-KRAB
UseTALENExpressionMammalianPromoterCAGAvailable SinceNov. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMTL3
Plasmid#127966Purposeconstitutive expression of KRAB-dCas9-BFP-KRAB from the AAVS1 locusDepositorInsertAAVS1-CAG-KRAB-dCas9-BFP-KRAB
UseTALENExpressionMammalianPromoterCAGAvailable SinceNov. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMH0006
Plasmid#135448PurposeHuman expression vector containing Ubiquitous Chromatin Opening Element (UCOE) upstream of EF1alpha promoter, dCas9 that is fused to NLS, tagBFP and a KRAB domain.DepositorInsertdCas9-BFP-KRAB
UseLentiviralTagstagBFPExpressionMammalianPromoterEF1AAvailable SinceJuly 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJR103
Plasmid#187242PurposeLentiviral sgRNA vector with mU6 sgRNA promoter, CR1 constant region, and UCOE EF1alpha driving PURO-BFP marker expressionDepositorInsertLentiviral sgRNA vector with mU6 sgRNA promoter, CR1 constant region, and UCOE EF1alpha driving PURO-BFP marker expression
UseLentiviralAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
crTet in pSLQ8453
Plasmid#183965PurposeU6-crTet-EF1a-Puro-T2A-BFP-WPREDepositorInsertcrTet
UseLentiviralTagsEF1a-Puro-T2A-BFPExpressionMammalianPromoterU6Available SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-H3.3-G34V
Plasmid#209433PurposeLentiviral packagable plasmid expressing FLAGGED human histone mutant H3.3-G34V with BFPDepositorInsertH3.3-G34V
ExpressionMammalianMutationG34VAvailable SinceDec. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
CRISPRoff-v2.1
Plasmid#167981PurposeExpresses CRISPRoff-v2.1 (DNMT3A-DNMT3L-XTEN80-dCas9-HA-2xNLS-BFP-KRAB) downstream of the CAG promoterDepositorInsertCRISPRoff-v2.1 (DNMT3A-DNMT3L-dCas9-BFP-KRAB)
Tags2xNLS, DNMT3A-DNMT3L, HA, KRAB, and tagBFPExpressionMammalianPromoterCAGAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBA904
Plasmid#122238PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs1 incorporated in the loop of the sgRNA constant region.DepositorInsertsgRNA with cs1 in stem loop 2 of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBA900
Plasmid#122237PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs2 incorporated at the 3' end of the sgRNA constant region.DepositorInsertsgRNA with cs2 at the 3' end of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBA950
Plasmid#122239PurposeCROP-seq vector optimized for sgRNA expression and CRISPRi activity. This vector expresses a eGFP-NT2 sgRNA with modified U6 promotor and sgRNA constant region.DepositorInsertBFP selectable marker, plus a modified mU6 promoter and sgRNA constant region for optimized CRISPRi activity
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPC1000
Plasmid#174829PurposeLentiviral Repair-seq vector containing CRISPRi sgRNA and SaPE2 prime edit siteDepositorInsertsCRISPRi SpCas9 sgRNA cassette
PuroR-P2A-BFP
UseCRISPR and LentiviralExpressionMammalianMutationDetailed in manuscriptPromoterEF1a and mouse U6Available SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQ2aB
Plasmid#124887PurposeBasic Retroviral backbone with multiple 2a sites, linkers, BFP and and IRES_puromycin from pQCXIPDepositorTypeEmpty backboneUseRetroviralTagsBlue Flourescent Protein, FlagExpressionMammalianPromoterCMVAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJH127
Plasmid#162483PurposeSEC plasmid containing LG1 homology arms and myo-2p::TIR1::F2A::BFP::AID*::NLS::tbb-2 3'UTR, for expression of TIR1 and nuclear BFP reporter in C. elegans.DepositorInsertmyo-2p::TIR1::F2A::AID*::NLS::tbb-2 3'UTR
UseCRISPRTagsmyo-2p::TIR1::F2A::AID*::NLS::tbb-2 3'UTRExpressionWormAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJH130
Plasmid#162484PurposeSEC plasmid containing LG1 homology arms and myo-3p::TIR1::F2A::BFP::AID*::NLS::tbb-2 3'UTR, for expression of TIR1 and nuclear BFP reporter in C. elegans.DepositorInsertmyo-3p::TIR1::F2A::AID*::NLS::tbb-2 3'UTR
UseCRISPRTagsmyo-3p::TIR1::F2A::AID*::NLS::tbb-2 3'UTRExpressionWormAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJH126
Plasmid#162482PurposeSEC plasmid containing LG1 homology arms and vha-8p::TIR1::F2A::BFP::AID*::NLS::tbb-2 3'UTR, for expression of TIR1 and nuclear BFP reporter in C. elegans.DepositorInsertvha-8p::TIR1::F2A::AID*::NLS::tbb-2 3'UTR
UseCRISPRTagsvha-8p::TIR1::F2A::AID*::NLS::tbb-2 3'UTRExpressionWormAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
H2B-Electra2
Plasmid#218929PurposeElectra2 fused to human H2B protein for nuclear localizationDepositorInsertH2B-Electra2 (H2B Synthetic, Human, Entacmaea quadricolor)
UseSynthetic BiologyTagsElectra2 and H2BExpressionMammalianAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS4077
Plasmid#131738PurposepLenti_CMV-mCherry-BghA_EF1alpha-BFPDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHALgMT
Plasmid#234792PurposeMammalian expression of yeast OMP25DepositorInsertOMP25
TagsLgBiTExpressionMammalianAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pReplace_donor_mcherry
Plasmid#149345PurposeDonor vector for the replacement of reporter BFP by mcherryDepositorInsertmcherry
ExpressionMammalianAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-BP
Plasmid#60496PurposeSB-transposon with inducible SfiI cloning site for GOI (contains firefly luciferase) and constitutive expression of BFP, rtTA and puromycin resistance geneDepositorTypeEmpty backboneUseTransposonExpressionMammalianPromoterTCE & RPBSAAvailable SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-BP
Plasmid#60512PurposeSB-transposon with constitutive bi-directional promoter, one side: SfiI cloning site for GOI (contains filler DNA), other side: BFP and puromycin resistance geneDepositorTypeEmpty backboneUseTransposonExpressionMammalianPromoterEF1a/RPBSAAvailable SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-BH
Plasmid#60499PurposeSB-transposon with inducible SfiI cloning site for GOI (contains firefly luciferase) and constitutive expression of BFP, rtTA and hygromycin resistance geneDepositorTypeEmpty backboneUseTransposonExpressionMammalianPromoterTCE & RPBSAAvailable SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCS4083
Plasmid#131739PurposeTwo Color Control Assay bicistronic BFP-mCherry-sTRSVctlDepositorInsertsTRSV
ExpressionMammalianAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-BB
Plasmid#60521PurposeSB-transposon with constitutive bi-directional promoter, one side: SfiI cloning site for GOI (contains filler DNA), other side: BFP and blasticidin resistance geneDepositorTypeEmpty backboneUseTransposonExpressionMammalianPromoterEF1a/RPBSAAvailable SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-BB
Plasmid#60505PurposeSB-transposon with inducible SfiI cloning site for GOI (contains firefly luciferase) and constitutive expression of BFP, rtTA and blasticidin resistance geneDepositorTypeEmpty backboneUseTransposonExpressionMammalianPromoterTCE & RPBSAAvailable SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-BH
Plasmid#60515PurposeSB-transposon with constitutive bi-directional promoter, one side: SfiI cloning site for GOI (contains filler DNA), other side: BFP and hygromycin resistance geneDepositorTypeEmpty backboneUseTransposonExpressionMammalianPromoterEF1a/RPBSAAvailable SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only