We narrowed to 24,135 results for: CRISPR
-
Plasmid#123363PurposeLentiviral vector with empty U6 cassette containing LbCpf1 direct repeat and U6 terminator, with constitutive expression of puromycin resistance, Firefly luciferase, and nuclear EGFP.DepositorInsertEGFP-NLS
UseCRISPR, Lentiviral, and LuciferaseExpressionMammalianPromoterEFSAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
SunTagng22aa
Plasmid#106438PurposeEncodes a SunTag CRISPR cas9 system that does not contain a guide RNA and therefore, does not target the TET1 catalytic domain to any specific region of the genome.DepositorInsertNOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-H2BC11-MMEJ
Plasmid#227333PurposeMMEJ Donor template for mStayGold-2A-Puro insertion into the C-terminus of the H2BC11 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 (Addgene #207755)DepositorInsertH2BC11 Short Homology Arms flanking a mStayGold-2A-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE3G-ZIM3-Cas9-P2A-GFP-PGK-Blasti
Plasmid#239604PurposeDoxycycline inducible CRISPRgenee construct with a blasticidin resistanceDepositorAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJMP1
Plasmid#79873PurposeBacillus subtilis dCas9 expression vector; integrates into lacA/ganADepositorInsertdCas9
UseCRISPRExpressionBacterialMutationD10A, H840APromoterxylAAvailable SinceOct. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
BPK4410 - human expression plasmid for SpCas9 Cluster 1 (HypaCas9)
Plasmid#101178PurposeHuman expression plasmid for SpCas9 Cluster 1 variant (HypaCas9): CMV-T7-hSpCas9-Cluster1(N692A, M694A, Q695A, H698A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-Cluster1(N692A/M694A/Q695A/H698A)
Tags3x FLAG and NLS (SV40)ExpressionMammalianMutationN692A/M694A/Q695A/H698APromoterCMVAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mNeon-Puro-TOMM20
Plasmid#207790PurposeDonor template for mNeon-2A-Puro insertion into the C-terminus of the TOMM20 locus. For mitochondria visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TOMM20 (Addgene #207789)DepositorInsertTOMM20 Homology Arms flanking a mNeon-Puro Cassette (TOMM20 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
CGBE1 (pRZ3885)
Plasmid#140252PurposeCMV promoter expression plasmid for UNG(E.coli)-rAPOBEC1(R33A)-nCas9-P2A-EGFPDepositorInserteUNG-BE4max(R33A)-ΔUGI
ExpressionMammalianMutationR33A in rAPOBEC1, D10A in Cas9PromoterCMVAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
loxP-G418-LoxP-TurboID-Rab11 HR
Plasmid#230026PurposeHomology repair plasmid for endogenous tagging of Rab11 at the N-terminus with TurboID and a V5 epitope tag. Contains a G418 resistance cassette for selection of edited cellsDepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mScarlet-LMNB1
Plasmid#207771PurposeDonor template for mScarlet insertion into the N-terminus of the LMNB1 locus for nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a mScarlet Tag (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFB-U6-sgNeuN-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128346PurposepAAV encoding control gRNA for CRISPR gRNAs listed aboveDepositorAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-LMNB1
Plasmid#227329PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the LMNB1 locus. For nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 (Addgene #207770)DepositorInsertLMNB1 Homology Arms flanking a Puro-2A-mStayGold (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-GOLGA2
Plasmid#227325PurposeDonor template for mStayGold insertion into the N-terminus of the GOLGA2 locus. For Golgi visualization. To be co-transfected with sgRNA plasmid px330-PITCh-GOLGA2 (Addgene #207791)DepositorInsertGOLGA2 Homology Arms flanking a mStayGold Tag (GOLGA2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgRNA-CLTA-mCherry
Plasmid#240637PurposeVector for expressing an sgRNA targeting CLTA promoter from the mouse U6 promoter and a puromycin resistance cassette and mCherry from the EF1Alpha promoter.DepositorInsertpuro-T2A-mCherry
UseCRISPRExpressionMammalianAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-gRNA hUbC-VP64-dSaCas9-VP64-T2A-Thy1.1
Plasmid#194279PurposeExpresses gRNA and VP64-dSaCas9-VP64 from lentiviral vectorDepositorInsertshumanized VP64 dSaCas9 VP64 T2A Thy1.1
gRNA
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhU6 and hUbCAvailable SinceFeb. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUbi-RZ-Lb
Plasmid#86197PurposeLbCpf1 Gateway gRNA entry plasmid using Zea mays Ubi promoter and ribozyme processingDepositorInsertgRNA cloning site
UseCRISPRPromoterMaize ubiquitin 1Available SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
6His-MBP-TEV-huAsCpf1
Plasmid#90095PurposeBacterial expression plasmid for protein purificationDepositorInserthuAsCpf1
Tags3xHA, 6xHis, MBP, Nucleoplasmin NLS, and TEV site…ExpressionBacterialAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMJ114
Plasmid#85995PurposeOne-guide Perturb-seq vector backbone; modified bovine U6 promoter; original constant regionDepositorInsertssgGFP-NT2
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermodified bovine U6-2Available SinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
AA061
Plasmid#216018PurposeFragmid fragment: (Cas protein) nickase Cas for prime editingDepositorHas ServiceCloning Grade DNAInsertnCas9-NG (H840A)_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA029
Plasmid#216009PurposeFragmid fragment: (Cas protein) nickase Cas for base editingDepositorHas ServiceCloning Grade DNAInsertnCas9-NG (D10A)_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMJ117
Plasmid#85997PurposeOne-guide Perturb-seq vector backbone; modified human U6 promoter; constant region 3DepositorInsertsEGFP-NT2_cr3
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermodified human U6Available SinceFeb. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMJ179
Plasmid#85996PurposeOne-guide Perturb-seq vector backbone; modified mouse U6 promoter; constant region 2DepositorInsertsEGFP-NT2_cr2
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermodified mouse U6Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-36XMYC array
Plasmid#236380PurposeExpression of array of 36 crRNAs targeting MYCDepositorInsert36xMYC crRNA array (MYC Human)
UseCRISPR and LentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-moxGFP-LMNB1
Plasmid#207773PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the LMNB1 locus for nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Puro-moxGFP Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSL1145 (pSPIN, pBBR1 backbone, R*MmeI)
Plasmid#160736PurposeSingle-plasmid V. cholerae CAST, encodes all proteins, crRNA, and donor DNA. Non-targeting crRNA with BsaI sites for spacer cloning. Mini-tn has MmeI site in R end for Tn-seq. pBBR1 backbone.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJMP2
Plasmid#79874PurposeBacillus subtilis sgRNA expression vector; integrates into amyEDepositorInsertsgRNA RR1
UseCRISPRExpressionBacterialPromotervegAvailable SinceSept. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC57-white[coffee]
Plasmid#84006PurposeDonor HR template carrying a 2,080 bp fragment of the Drosophila melanogaster white[coffee] allele and silent mutations conferring resistance to white sgRNAs-1, -2, -3, and -4DepositorInsertA 2,080 bp fragment of the white[coffee] allele (w Fly)
UseUnspecifiedMutationA GC-to-AA mutation that creates a G589E missense…Available SinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pC001 - huLshC2C2-MBP for bacterial expression
Plasmid#79150PurposeExpresses human codon-optimized LshC2c2 for purification in E. coliDepositorInsertC2c2
ExpressionBacterialPromoterT7Available SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only