We narrowed to 15,732 results for: LEA
-
Plasmid#127906PurposeHDR (donor) Plasmid for Inserting AID-GFP-2A-Puro into the 3' end of the Human HP1a GeneDepositorInsertHP1 (CBX5 Human, Mustard Weed)
UseDonor plasmidTagsGFP, AID, PuroRMutationInserting GFP AID 2A Puro into mouse 3' Hp1aAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-3*Flag-APEX2 C-term EWSR1
Plasmid#187586PurposeExpress FLAG epitope and APEX2-tagged EWSR1 fusion protein in mammalian cellsDepositorAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Split Cas9 D10A Nickase with GyrA intein
Plasmid#58695PurposeExpresses N-terminus of D10A SpCas9 nickase domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 nickase productionDepositorInsertD10A Nickase humanized S. pyogenes Cas9 with Gyra Nsplit Intein
UseAAV and CRISPRTagsGyrA Nsplit Intein, HA Tag, and NLSExpressionMammalianMutationD10A nickase converting mutation to SpCas9PromoterCBhAvailable SinceSept. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
TRIPZ-CTID195-GSQ-UBnc-PURO
Plasmid#208037PurposeEnables inducible expression of C-terminal Split-TurboID-fused UBnc, to perform Ubiquitin-ID; nc = non-cleavable mutation; selection with puromycinDepositorInsertUbnc (UBC Human)
UseLentiviralTagsMyc, C-terminal Split-TurboIDMutationL73P Mutation near C-terminus suppresses cleavage…PromotertetO/UBCAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-TadCBEd-SpCas9-P2A-EGFP (BKS327)
Plasmid#223123PurposepCMV and pT7 Human expression plasmid for TadCBEd-SpCas9 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadCBEd-SpCas9-2xUGI-P2A-EGFP
UseCRISPRTags2xUGI-BPNLS-P2A-EGFP and BPNLS-TadA-CDdExpressionMammalianMutationTadA-CDd mutations; nSpCas9=D10APromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpyTag-Flag-Lbr-V5-mCherry
Plasmid#235094PurposeLbr mCherry fusion protein without MCP domainDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-PEmax-P2A-EGFP (LM1589)
Plasmid#223136PurposepCMV and pT7 Human expression plasmid for PEmax(nSpCas9(H840A)-M-MMLV_RT**)-P2A-EGFPDepositorInserthuman codon optimized PEmax-P2A-EGFP
UseCRISPRTagsBPNLS and NLS(SV40)-NLS(cMyc)-P2A-EGFPExpressionMammalianMutationM-MLV mutations from PE2 (Anzalone et al. Nature …PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCIG-FGF13A
Plasmid#220793PurposeTo express the human FGF13 isoform 1(FGF13A) in mammalian cells together with EGFPDepositorInsertFGF13 (FGF13 Human)
Available SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBactin-AcGFP-128-425-Akap9
Plasmid#196871PurposeExpression of fragment 128-425 from A-Kinase Anchoring Protein 9 (Akap9) fused to AcGFP. Used to displace endogenous Akap9 from GolgiDepositorInsertAcGFP-Akap9 (128-425) (Akap9 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-PACT-mOrange2-hCM1
Plasmid#196868PurposeExpression of Pericentrin-AKAP450 centrosomal targeting (PACT) domain fused to mOrange2 and human (h) Centrosomin motif 1 (CM1). PACT targets CM1 to the centrosomeDepositorInsertPACT-mOrange2-hCM1 (Akap9 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBIG1e-CDK12/Cyclin K
Plasmid#231730PurposeProtein expression in insect cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBIG1e-CDK13/Cyclin K
Plasmid#231731PurposeProtein expression in insect cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-7xTRE-3xeGFP
Plasmid#191206PurposeGFP expression under the control of TRE promotorDepositorInsert3X GFP
UseAAVExpressionMammalianPromoterTREAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET His6 MBP TEV HDAC8_374
Plasmid#122174PurposeExpresses a truncated construct of histone deacetylase 8 for crystallography bearing an N-terminal tobacco etch virus protease-cleavable hexahistidine-maltose binding protein tagDepositorInsertHis6 MBP TEV HDAC8_374 (HDAC8 Human)
Tagshexahistidine tag and tobacco etch virus protease…ExpressionBacterialMutationResidues Met1–Pro7 and H375-V377 have been delete…PromoterT7Available SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetON)(TRE-SEAP
Plasmid#210513Purposeexpresses PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetON and SEAP reporter in mammalian cellsDepositorInsertssecreted alkaline phosphatase
CMV-PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq
TagsMycExpressionMammalianPromoterCMV and TetOAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
t1-435
Plasmid#166578PurposeFor expression of human talin head (residues 1-435) in E. coli. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertTln1 Head (1-435) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-435 onlyAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLED.NPL
Plasmid#193014PurposeNeuron-specific reporter (CBh promoter, Pls3 exon, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Htt171-18Q-myc-WPRE
Plasmid#107936PurposeAdeno-Associated viral (AAV) vector plasmid expressing exon1 of wild type HTT (wtHTT, 18 polyQ repeats) in neuronsDepositorAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-TO/CMV-puro-DD-PAmCherry1-KRas G12D
Plasmid#177320PurposeLentiviral vector expressing PAmCherry1-tagged KRas 4B G12D mutant, with an N-terminal dimerization domain (DD).DepositorInsertKRAS 4B (KRAS Human)
UseLentiviralTagsFKBP-derived dimerization domain (DD, or DmrB) an…ExpressionMammalianMutationG12DPromoterTetOn-CMVAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only