We narrowed to 22,937 results for: Tes
-
Plasmid#195379PurposeMammalian expression of a human PTPN22 mutant (intron 18-runon) with FLAG tagDepositorAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only
-
FLAG-Ex1-17-PTPN22
Plasmid#195375PurposeMammalian expression of a human PTPN22 mutant (exon 1-17) with FLAG tagDepositorInsertPTPN22 (PTPN22 Human)
TagsFLAGExpressionMammalianMutationPTPN22 mutant containing exon 1 to 17Available SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPhiC31-actIIORF4
Plasmid#190785PurposeThe PhiC31-phage based integration vector containing the actII-ORF4 gene under the control of strong kasOp* promoterDepositorInsertsT5 terminator
actII-4
kasOp*
ExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-ALDH1A3gRNA3
Plasmid#189748PurposeThe construct was used for expression of gRNA for knocking out of the ALDH1A3 gene in Cas9 expressing cells.DepositorInsertALDH1A3 gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-MYC.Mm.EPC1
Plasmid#184653PurposeRetroviral expression of mouse Epc1DepositorAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-MYC.Mm.EPC2
Plasmid#184654PurposeRetroviral expression of mouse Epc2DepositorAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Dendra-Rab11a
Plasmid#184038PurposeExpresses red to green photoconvertible Rab11aDepositorAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDRf1-4CL5-AtSDT (JBEI-11535)
Plasmid#87934PurposeCo-expression in S.cerevisiae of 4CL5 and AtSDTDepositorAvailable SinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pM-ErbB4-delta-kinase-PY1 mutant
Plasmid#17801DepositorInsertErbB4 (ERBB4 Human)
TagsGAL4-BDExpressionMammalianMutationCarboxy-terminal fragment, amino acids 988-1292, …Available SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral mBmal1-Luc
Plasmid#182762PurposeLentiviral vector encoding the promoter region of mouse Bmal1 gene driving a luciferase reporterDepositorAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-eGFP-NLS-RNF168
Plasmid#133977Purposemammalian expression vector of eGFP tagged wild type RNF168DepositorInsertRNF168 (RNF168 Human)
TagseGFPExpressionMammalianMutationsiRNA resistant sequence: GAGGAGTCGTGTTTATTGAPromoterCMVAvailable SinceNov. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
HIP-flash (HOP-flash mutant)
Plasmid#83466PurposeNegative control for HOP-flash. 7xmut TEAD binding sites with minimal promoter plus luciferase reporter geneDepositorInsertMultimerized mutated TEAD binding sites in the promoter of CTGF with minimal promoter (CCN2 Human)
UseLuciferaseAvailable SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FUW TetO HA-AMPKa1 WT
Plasmid#69824PurposeExpresses AMPK alpha 1 in mammalian cells in a doxycycline inducible mannerDepositorInsert5'-AMP-activated protein kinase catalytic subunit alpha-1 (PRKAA1 Human)
UseLentiviralTagsHAExpressionMammalianPromoterminimal CMV promoter with tetracycline operatorAvailable SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
tetO-Hand2
Plasmid#46028DepositorAvailable SinceJuly 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET-15b-hAR-663-919
Plasmid#89083Purposebacterial expression of human androgen receptor ligand bindng domain amino acid residues 663-919 with histidine tagDepositorInserthAR ligand binding domain (AR Human)
TagsHisExpressionBacterialMutationaa 663-919PromoterT7Available SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.2/V5-DEST RBM14-V5
Plasmid#69823PurposeExpresses RBM14-V5 in mammalian cellsDepositorInsertRNA-binding protein 14 (RBM14 Human)
UseRetroviralTagsv5ExpressionMammalianPromotercmvAvailable SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
hFLT1
Plasmid#83435Purposehuman VEGFR1 with HA and FLAG tagDepositorInserthuman VEGFR1 (FLT1 Human)
TagsFlag and MycExpressionMammalianMutationHA-tag was inserted 30 AA downstream of the FLT1 …PromoterCMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3-GST-Tev-Af1521-myc
Plasmid#196239PurposeN-terminal GST fusion of Af1521(WT) with a TEV protease site located between the GST tag and Af1521 and a myc tag on the C terminusDepositorInsertN-terminal GST fusion of Af1521(WT) with a TEV protease site between GST and Af1521 encoding a C-terminal myc tag
TagsGST tag and myc tagExpressionBacterialAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.2/V5-DEST MTFR1L-V5
Plasmid#69822PurposeExpresses MTFR1L-V5 in mammalian cellsDepositorInsertMitochondrial fission regulator 1-like (MTFR1L Human)
UseRetroviralTagsv5ExpressionMammalianPromotercmvAvailable SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT5_TRE-ARID1A-FLAG_PGK-H2B-RFP
Plasmid#203965PurposeDox inducible FLAG tag ARID1a in a sleeping beauty transposon constructDepositorInsertARID1A (Arid1a Mouse)
UseSleeping beauty transposonTagsFLAGExpressionMammalianPromoterTREAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVH-EF1a-GFP-P2A-OCT4
Plasmid#130692PurposeLentiviral plasmids encoding human OCT4 (POU5f1) along with GFP linked via P2A.DepositorInserthuman OCT4 (POU5F1 Human)
UseLentiviralAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-EcTrp-TGA
Plasmid#228780PurposeaaRS/tRNA system for incorporation of 5HTP within proteins in mammalian cells at TGA codonDepositorInsertsEcTrpRS
EcWtR
UseBaculoviralExpressionMammalianMutationTGA suppressorAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 FLAG FBXO31
Plasmid#236429Purposetransient overexpression of FBXO31 in mammalian cellsDepositorAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-EcTyr-TAG
Plasmid#228782PurposeEcTyr aaRS/tRNA system for mammalian ncAA incorporationDepositorInsertsEcTyrRS
EcYtR
BstR
UseBaculoviralExpressionMammalianMutationTAG suppressorAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hPGK-eGFP-SynaptoZip
Plasmid#122523PurposeLentiviral expression of the synaptic activity-marker SynaptoZip fused to eGFP driven by hPGK promoterDepositorInserteGFP-SynaptoZip (Vamp2 Rat)
UseLentiviralTagsMyc and eGFPExpressionMammalianPromoterhPGKAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-ORP8-H514A-H515A
Plasmid#208360PurposeMammalian expression of fluorescent N-terminally tagged H514A-H515A mutant of ORP8DepositorAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVH-EF1a-GFP-P2A-KLF4
Plasmid#130694PurposeLentiviral plasmids encoding human KLF4 with co-expressoin of GFP mediated by P2A.DepositorInserthuman KLF4 (KLF4 Human)
UseLentiviralAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-DTX2-1-178-EGFP-Hygro
Plasmid#238094PurposeExpression of structurally predicted WWE domain of DTX2 with EGFP on C terminalDepositorInsertDTX2 (DTX2 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationaa 1-178 onlyPromoterEF1alphaAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
GAL-hAR-658-919
Plasmid#89082Purposemammalian expression of human androgen receptor ligand binding domain 658-919 amino acids linked to GAL4 DNA binding domainDepositorAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAP03-sp44/p21
Plasmid#120232PurposeCarries bidirectional promoter cassette containing sp44 and p21 promoters and apramycin resistance gene flanked by two FRT sites that can be amplified with homology sequence for refactoring.DepositorInsertbidirectional promoter cassette containing sp44 and p21 promoters and apramycin resistance gene flanked by two FRT sites
UseSynthetic BiologyMutationaac(3)IV (apramycin resistance gene)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-PQBP1
Plasmid#25804DepositorAvailable SinceSept. 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRK5 Myc-tagged PSK
Plasmid#197149PurposeExpression of MYC-tagged PSK1-alpha / TAOK2 in mammalian cellsDepositorAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-eGFP-SynaptoZip
Plasmid#122525PurposeAAV expression of the synaptic activity-marker SynaptoZip fused to eGFP driven by human Synapsin promoterDepositorAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Sec22b-shR
Plasmid#208358PurposeMammalian expression of fluorescent N-terminally tagged shRNA resistant Sec22bDepositorInsertSec22b (Sec22b Rat)
TagsEGFPExpressionMammalianMutationfour silent mutations introduced to render shRNA …PromoterCMVAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-RaichuEV-Rac1(T17N)
Plasmid#164902PurposeExpresses a Rac1 FRET sensor RaichuEV-Rac1 which contains a dominant negative mutation T17N in the Rac1 domainDepositorInsertRaichuEV-Rac1 (RAC1 Human)
ExpressionMammalianMutationT17N mutation in the Rac1 domain which make the s…Available SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Bmpr2ΔKinase gRNA resistant
Plasmid#163411PurposeExpresses BMPR-2ΔKinase resistant to the gRNAs(#163388-90) in mammalian cellsDepositorInsertBmpr2 (Bmpr2 Mouse)
ExpressionMammalianMutationThe kinase domain (202-500 aa) is deleted. gRNA-t…Available SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLPC-FLAG.Mm.DMAP1
Plasmid#184650PurposeRetroviral expression of mouse DMAP1DepositorAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcFLAG-CSK-delta SH3 (73 to450 amino acids)
Plasmid#74504PurposeOverexpression of CSK delta SH3 in mammalian cellsDepositorInsertCSK (CSK Human)
TagsFLAGExpressionMammalianMutationdel-SH3 (73 to450 amino acids)PromoterCMVAvailable SinceMay 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
FUW TetO HA-AMPKa1 AS
Plasmid#69825PurposeExpresses AMPK alpha 1 in mammalian cells in a doxycycline inducible mannerDepositorInsert5'-AMP-activated protein kinase catalytic subunit alpha-1 (PRKAA1 Human)
UseLentiviralTagsHAExpressionMammalianPromoterminimal CMV promoter with tetracycline operatorAvailable SinceMay 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCS2-zfIl34
Plasmid#168112PurposeExpress zebrafish Il34, mRNA synthesisDepositorInsertIl34 (il34 Zebrafish)
UseVertebrate expression (zebrafish, chicken, xenopu…ExpressionMammalianAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
p2xFLAGhYAP2-WW1-mutant
Plasmid#17795DepositorInsertYes-kinase associated protein (YAP1 Human)
Tags2xFlagExpressionMammalianMutationTryptophan 199 to Alanine; Proline 202 to AlanineAvailable SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
p2xFLAGhYAP2-WW2-mutant
Plasmid#17796DepositorInsertYes-kinase associated protein (YAP1 Human)
Tags2xFlagExpressionMammalianMutationTryptophan 258 to Alanine Proline 261 to AlanineAvailable SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
pECE M2-SH3PXD2A 8 serines mutated to alanines
Plasmid#69816PurposeExpresses M2-SH3PXD2A in mammalian cellsDepositorInsertSH3 and PX domain-containing protein 2A (SH3PXD2A Human)
TagsFLAGExpressionMammalianPromoterSV40 early promoterAvailable SinceMay 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
FUW TetO NET1A-V5 WT
Plasmid#69828PurposeExpresses NET1A-V5 in mammalian cells in a doxycycline inducible mannerDepositorInsertNeuroepithelial cell-transforming gene 1 protein A (NET1 Human)
UseLentiviralTagsv5ExpressionMammalianPromoterminimal CMV promoter with tetracycline operatorAvailable SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pECE M2-SH3PXD2A 6 serines mutated to alanines
Plasmid#69815PurposeExpresses M2-SH3PXD2A in mammalian cellsDepositorInsertSH3 and PX domain-containing protein 2A (SH3PXD2A Human)
TagsFLAGExpressionMammalianPromoterSV40 early promoterAvailable SinceMay 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.2/V5-DEST NET1A S46A
Plasmid#69818PurposeExpresses NET1A-V5 in mammalian cellsDepositorInsertNeuroepithelial cell-transforming gene 1 protein A (NET1 Human)
TagsV5ExpressionMammalianMutationS46APromoterCMVAvailable SinceApril 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLVX-FUT8-IRES-puro
Plasmid#250319PurposeExpression of human FUT8 with C-terminal myc and FLAG tags in mammalian cellsDepositorInsertFUT8 (FUT8 Human)
UseLentiviralTagsmyc and FLAGExpressionMammalianMutationsynonymous mutations to DNA encoding Asp306PromoterCMV promoterAvailable SinceMarch 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-PARP11-22-122-EGFP-Hygro
Plasmid#238097PurposeExpression of structurally predicted WWE domain of PARP11 with EGFP on C terminalDepositorInsertPARP11 (PARP11 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationaa 22-112 onlyPromoterEF1alphaAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-PARP12-298-462-Hygro
Plasmid#238098PurposeExpression of structurally predicted WWE domain of PARP12 with EGFP on C terminalDepositorInsertPARP12 (PARP12 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationaa 298-462 onlyPromoterEF1alphaAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only