We narrowed to 34,416 results for: CaS
-
Plasmid#197424Purposeπ-element knock-in into exon 5 of MAPRE1DepositorInsertMAPRE1 gRNA #1 (targets Exon 5) for π-element knock-in (MAPRE1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP_MAPRE1-KI-gRNA#2
Plasmid#197425Purposeπ-element knock-in into exon 5 of MAPRE1DepositorInsertMAPRE1 gRNA #2 (targets Exon 5) for π-element knock-in (MAPRE1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP_MAPRE1-KI-gRNA#3
Plasmid#197426Purposeπ-element knock-in into exon 5 of MAPRE1DepositorInsertMAPRE1 gRNA #3 (targets Exon 5) for π-element knock-in (MAPRE1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-BCAS2
Plasmid#192294PurposeGateway entry vector for an inducible 3xFLAG-BCAS2DepositorInsertBCAS2 (BCAS2 Human)
UseGateway entry vectorTags3xFLAGExpressionMutationPromoterAvailable sinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AP76_pU.CAG.Cas9-D10A-K848A.rBGpA
Plasmid#199253PurposeExpression construct encoding the high specificity SpCas9-KA-D10A nickaseDepositorInsertHigh specificity S. pyogenes Cas9-D10A-KA nickase
UseCRISPRTags3XFLAG epitope, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianMutationD10A K848APromoterCAG promoterAvailable sinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; T2_gRNA
Plasmid#197647PurposepDEL160; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type II sgRNADepositorInsertszCREST3
Cas9
nrg1 type II sgRNA
UseTol2 destination vectorTagsExpressionMutationPromoterAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; T1_gRNA
Plasmid#199332PurposepDEL159; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type I sgRNADepositorInsertszCREST3
Cas9
nrg1 type I sgRNA
UseTol2 destination vectorTagsExpressionMutationPromoterAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-sgHPRT1
Plasmid#196713PurposeCRISPR-KO. WT-SpCas9 and sgRNA targeting HPRT1. Editing-competent cells can be selected with 6-TGDepositorInsertCas9-T2A-BSD-U6-sgHPRT1
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSExpressionMutationPromoterEF1a/hU6Available sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-CcuCas9
Plasmid#192127PurposeExpresses CcuCas9DepositorInsertCcuCas9
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas-mut4/1_2_VB
Plasmid#186444PurposeEncodes Cas4(K81A)/1, Cas2, leader, repeat and one spacer from A. acidoterrestris (type V-B)DepositorInsertCas4/1 and Cas2
UseCRISPRTagsExpressionMutationCas4 domain (K81A)PromoterT7Available sinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp2Cas9
Plasmid#192126PurposeExpresses Hsp2Cas9DepositorInsertHsp2Cas9
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1Cas9
Plasmid#192125PurposeExpresses Hsp1Cas9DepositorInsertHsp1Cas9
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459_V2.0_pSpCas9(BB)-2A-Puro_T-REX17_Ex1_KI
Plasmid#195504PurposeCas9-2A-Puro expression vector bearing a sgRNA targeting Exon 1 of human lncRNA T-REX17DepositorInsertsgRNA
UseCRISPRTags3XFLAG, Puro, and T2AExpressionMammalianMutationPromoterU6Available sinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAS-mak10 gRNA
Plasmid#160385PurposeExpresses guide RNA for targeting MAK10 in yeastDepositorInsertmak10 gRNA
UseTagsExpressionYeastMutationPromoterRNA pol III promoter (tRNA-Tyr)Available sinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-1_mNeongreen-Uricase
Plasmid#182416PurposeBacterial expression of mNeongreen-uricase fusionDepositorInsertmNeongreen-uricase
UseTagsmNeongreenExpressionBacterialMutationPromoterT7Available sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
RCAS.Sfi Akt1-K179M
Plasmid#196375PurposeAkt1 kinase negative mutant K179M in avian expression vectorDepositorInsertc-akt1 K179M
UseRetroviral; AvianTagsHAExpressionMutationPromoterAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
RCAS myr-c-P3k
Plasmid#196373PurposeOncogenic with addition of a myristylation signal and expresses in avian cellsDepositorInsertMyr-c-P3k-FLAG
UseRetroviral; AvianTagsflag and myristoylationExpressionMutationPromoterAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
CASK scFv [K56A/57]
Plasmid#190492PurposeMammalian Expression of CASK scFV. Derived from hybridoma K56A/57.DepositorInsertCASK (Homo sapiens) recombinant scFV (CASK Mouse)
UseTagsHA, Sortase, 6xHisExpressionMammalianMutationPromoterCMVAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
CASK scFv [K56A/50]
Plasmid#190491PurposeMammalian Expression of CASK scFV. Derived from hybridoma K56A/50.DepositorInsertCASK (Homo sapiens) recombinant scFV (CASK Mouse)
UseTagsHA, Sortase, 6xHisExpressionMammalianMutationPromoterCMVAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-CASK [K56A/57]
Plasmid#190283PurposeMammalian Expression Plasmid of anti-CASK (Human). Derived from hybridoma K56A/57.DepositorInsertanti-CASK (Homo sapiens) recombinant Mouse monoclonal antibody (CASK Mouse)
UseTagsExpressionMammalianMutationPromoterDual CMVAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUBI-RZ-Cas12j2
Plasmid#189781PurposeCas12j2 (CasΦ) Gateway gRNA entry plasmid using Zea mays Ubi promoter and HH, HDV ribozyme processingDepositorInsertgRNA cloning site
UseCRISPRTagsExpressionMutationPromoterAvailable sinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28_redesigned_Caspase-4_ANR261ENP_D315H_M318K_T352K_enzymatic domain
Plasmid#183387PurposeOverexpression of catalytic domain of inflammatory caspase in bacteriaDepositorInsertredesigned Caspase-4 (AA94-377) (CASP4 Human)
UseTagsHis-TEVExpressionBacterialMutationANR261ENP, D315H, M318K, T352KPromoterT7Available sinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorInsertCASP8 (CASP8 Human)
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15541_dCBE-SuperFi-Cas9
Plasmid#184371PurposeMammalian expression of nuclease inactive SuperFi-Cas9 CBE base editorDepositorInsertdCBE-SuperFi-Cas9
UseCRISPRTags3X FLAG, SV40 NLS, and UGIExpressionMammalianMutationD10A, H840A, Y1010D, Y1013D, Y1016D, V1018D, R101…PromoterEF-1α core promoterAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15543_dABE-SuperFi-Cas9
Plasmid#184373PurposeMammalian expression of nuclease inactive SuperFi-Cas9 ABE7 base editorDepositorInsertdABE-SuperFi-Cas9
UseCRISPRTagsFLAG, SV40 NLS, and nucleoplasmin NLSExpressionMammalianMutationD10A, H840A, Y1010D, Y1013D, Y1016D, V1018D, R101…PromoterEF-1α core promoterAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15545_dABE8e-SuperFi-Cas9
Plasmid#184375PurposeMammalian expression of nuclease inactive SuperFi-Cas9 ABE8e base editorDepositorInsertdABE8e-SuperFi-Cas9
UseCRISPRTagsNucleoplasmin NLS and SV40 NLSExpressionMammalianMutationD10A, H840A, Y1010D, Y1013D, Y1016D, V1018D, R101…PromoterEF-1α core promoterAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-H2BC11_sgRNA
Plasmid#183883PurposepX459V2.0-HypaCas9 plasmid with H2BC11 sgRNA for C-terminal tagging of H2B histones in human cells.DepositorInsertH2BC11 sgRNA spacer (H2BC11 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-MYH10_sgRNA
Plasmid#183887PurposepX459V2.0-HypaCas9 plasmid with MYH10 sgRNA for N-terminal tagging of myosin heavy chain 10 in human cells.DepositorInsertMYH10 sgRNA spacer (MYH10 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-CfANLN_sgRNA
Plasmid#183880PurposepX459V2.0-HypaCas9 plasmid with cfANLN sgRNA for N-terminal tagging of anillin in canine (Canis familiaris) cells.DepositorInsertCanis familiaris ANLN sgRNA spacer
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJCC_103 SpCas9 T1337C
Plasmid#179525PurposeFor bacterial expression of SpCas9 T1337C (for DNA cross-linking) with an N-terminal His-MBP tagDepositorInsertSpCas9 T1337C
UseTags10X His, TEV protease cleavage site, and maltose-…ExpressionBacterialMutationchanged threonine 1337 to cysteinePromoterAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
1137B=Hsp70Bb-Cas9
Plasmid#153284PurposeThe attB plasmid harboring the Hsp70Bb-Cas9-T2A-eGFP-p10 and a mini-white marker.DepositorInsertpHsp70Bb-SpCas9-T2A-eGFP-p10 (cas9 Synthetic)
UseCRISPRTagseGFPExpressionInsectMutationPromoterDmel Hsp70BbAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gltA1-gltA2
Plasmid#71348PurposegltA1-gltA2 targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertgltA1-gltA2 guide array
UseTagsExpressionBacterialMutationPromoterE . coli ugpB gene promoter, low phosphate induct…Available sinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-udhA-xylA
Plasmid#158612PurposeLow phosphate inducible gRNA array to silence the xylA and udhA promotersDepositorInsertudhA-xylA guide array
UseTagsExpressionBacterialMutationPromoterE . coli ugpB gene promoter, low phosphate induct…Available sinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gltA2-xylA
Plasmid#158613PurposeLow phosphate inducible gRNA array to silence the xylA and gltA2 promotersDepositorInsertgltA2-xylA guide array
UseTagsExpressionBacterialMutationPromoterE . coli ugpB gene promoter, low phosphate induct…Available sinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-zwf-xylA
Plasmid#158614PurposeLow phosphate inducible gRNA array to silence the xylA and zwf promotersDepositorInsertzwf-xylA guide array
UseTagsExpressionBacterialMutationPromoterE . coli ugpB gene promoter, low phosphate induct…Available sinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
6xHis-MBP-huMlCas12a
Plasmid#174678PurposeExpresses 6xHis-MBP tagged MlCas12aDepositorArticleInserthuMlCas12a
UseCRISPR and Synthetic BiologyTags6xHis, MBP, TEV and NLS, 6xHis, 3xHAExpressionBacterialMutationPromoterT7Available sinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 C-FKBP-Cas9
Plasmid#162729PurposeMammalian expressionDepositorInsertFKBP F36V
UseCRISPRTags3xFLAGExpressionMammalianMutationPromoterCBhAvailable sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
L2_NOP1gRNA-Cas9-CsA
Plasmid#136139PurposePlasmid with NOP1-gRNA to tranform Mp as CRISPR control. Contains Cas9 and HygRDepositorInsertp5-35Sx2:HygR p5-MpU6:NOP1gRNA1 p5-MpEF1a:Cas9-NLS
UseSynthetic BiologyTagsExpressionPlantMutationBsaI/ SapI domesticatedPromoterAvailable sinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
L2_2xNOP1gRNA-Cas9-CsA
Plasmid#136140PurposePlasmid with 2 different NOP1-gRNA. Targets 500 bp apart in the genome. To tranform Mp as CRISPR control. Contains Cas9 and HygRDepositorInsertp5-35S:HygR p5-MpU6:NOP1gRNA2 p5-MpU6:NOP1gRNA1 p5-MpEF1a:Cas9-NLS
UseSynthetic BiologyTagsExpressionPlantMutationBsaI/ SapI domesticatedPromoterAvailable sinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a-KRAB_crRNA Td2
Plasmid#176261PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged to the KRAB domain and Nlux and crRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseExpressionMutationD917A and E1006A mutations to inactivate the endo…PromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR2
Plasmid#176245PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationPromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR3
Plasmid#176246PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 3DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationPromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
6xHis-MBP-huCMaCas12a
Plasmid#174679PurposeExpresses 6xHis-MBP tagged CMaCas12aDepositorArticleInserthuCMaCas12a
UseCRISPR and Synthetic BiologyTags6xHis, MBP, TEV and NLS, 6xHis, 3xHAExpressionBacterialMutationPromoterT7Available sinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
6xHis-MBP-huPxCas12a
Plasmid#174675PurposeExpresses 6xHis-MBP tagged PxCas12aDepositorArticleInserthuPxCas12a
UseCRISPR and Synthetic BiologyTags6xHis, MBP, TEV and NLS, 6xHis, 3xHAExpressionBacterialMutationPromoterT7Available sinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
6xHis-MBP-huPrCas12a
Plasmid#174674PurposeExpresses 6xHis-MBP tagged PrCas12aDepositorArticleInserthuPrCas12a
UseCRISPR and Synthetic BiologyTags6xHis, MBP, TEV and NLS, 6xHis, 3xHAExpressionBacterialMutationPromoterT7Available sinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
6xHis-MBP-huBfCas12a
Plasmid#174672PurposeExpresses 6xHis-MBP tagged BfCas12aDepositorArticleInserthuBfCas12a
UseCRISPR and Synthetic BiologyTags6xHis, MBP, TEV and NLS, 6xHis, 3xHAExpressionBacterialMutationPromoterT7Available sinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDSARN-vasa-eSpCas9sv40
Plasmid#173670PurposeeSpCas9 expression vector for AnophelesDepositorInserteSpCas9 with Anopheles vasa promoter and SV40 terminator
UseCRISPRTagsExpressionInsectMutationmutations in Cas9 reducing off-target activity (S…PromotervasaAvailable sinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-e1 sgRNA / hSpCas9
Plasmid#172830PurposeMammalian expression of a sgRNA targeting the exon 2 position 1 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the exon 2 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-e2 sgRNA / hSpCas9
Plasmid#172831PurposeMammalian expression of a sgRNA targeting the exon 2 position 2 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the exon 2 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_Camk2a sgRNA / hSpCas9
Plasmid#172839PurposeMammalian expression of a sgRNA targeting the intron 17 (last intron) of Camk2a (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 17 of Camk2a under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only