We narrowed to 494 results for: blasticidin resistance
-
Plasmid#211819Purposelentiviral vector expressing SpCas9 and tracrRNA for stable cell line extablishmentDepositorInsertSpCas9, tracrRNA and blasticidin resistance gene
UseLentiviralExpressionMammalianPromoterU1a promoter and miniU6 promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiTet-CSK-P2A-mCherry BlastR
Plasmid#186742PurposeDox inducible CSK-P2A-mCherry expression construct cloned into a lentiviral backbone containing a blasticidin resistance geneDepositorAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHSP70B-CP6-bsr
Plasmid#165878PurposeBasic Blasticidin resistance cassette in Alpha1, lacks physical marker or attB siteDepositorInsertBasic Selection Vector
UseSynthetic BiologyAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
CD_bsd
Plasmid#139945PurposeResistance geneDepositorInsertblasticidin-S deaminase
UseSynthetic BiologyAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2_3xFLAG_V5_ eGFP_V5
Plasmid#160111PurposeExpresses eGFP in mammalian cellsDepositorInserteGFP
UseLentiviralTags3xFLAG, V5ExpressionMammalianAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 sgNRF2-4
Plasmid#186839Purposeknock out NRF2 in mammalian cellsDepositorInsertNrf2 (Nuclear factor-erythroid factor 2-related factor 2) (NFE2L2 Human)
UseCRISPR and LentiviralAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 sgNRF2-3
Plasmid#186838Purposeknock out NRF2 in mammalian cellsDepositorInsertNrf2 (Nuclear factor-erythroid factor 2-related factor 2) (NFE2L2 Human)
UseCRISPR and LentiviralAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMA4000
Plasmid#184857PurposeCre-excisable TFAM in Blasticidin-resistannce retroviral vectorDepositorAvailable SinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
BII-ChBtW-mADAR2-short
Plasmid#175588Purposemammalian expression of mouse short Adar2, blasticidine selectionDepositorInsertShort Mouse Adar2
TagsFlagExpressionMammalianPromotercmvAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide Blast
Plasmid#199622PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and blasticidin resistance from EF-1a promoter.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2 blast
Plasmid#98293PurposeVariant of lentiCRISPRv2 that confers blasticidin S resistanceDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralPromoterEF-1aAvailable SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-UbC-Tet1v4-dCas9
Plasmid#232180PurposeTet1v4-dCas9 from Nuñez et al. 2021, in a lentiviral cassette with blasticidin resistance, for expression in mammalian cellsDepositorInsertTet1 catalytic domain - XTEN80 linker - dead Cas9 - 2A - BlastR (TET1 Human, S. pyogenes)
UseLentiviralTagsFLAGExpressionMammalianMutationD10A, H840APromoterhUbCAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti‐Cas9‐2A‐Blast
Plasmid#73310PurposeLentiviral vector expressing human codon-optimized S. pyogenes FLAG-tagged Cas9 and blasticidin resistance from EFS promoterDepositorInsertCas9
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEFS-NSAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Bsd-CMV-MDM4
Plasmid#202669PurposeMDM4 overexpression vector with blasticidin resistanceDepositorAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 blast
Plasmid#104997PurposeThis lentiviral construct delivers hSpCas9 and blasticidin S resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSCAR_sgRNA_blast-tagBFP-lox5171
Plasmid#162072Purpose3rd generation lentivirus sgRNA delivery backbone with Cre-removable tagBFP reporter and blasticidin resistanceDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterU6, EF1aAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSCAR_sgRNA_blast-tagBFP-lox2272
Plasmid#162071Purpose3rd generation lentivirus sgRNA delivery backbone with Cre-removable tagBFP reporter and blasticidin resistanceDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterU6, EF1aAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPL001-BBTK
Plasmid#184751PurposeBig-IN positive control payload encoding EF1a-driven GFP-T2A-BSD. Harbors a backbone counterselectable TK cassette.DepositorInsertpEF1a-eGFP-T2A-BSD-bGHpA
UseCre/Lox, Mouse Targeting, and Synthetic Biology ;…ExpressionMammalianPromoterEF1aAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiTet-RAB10-T2A-RABIF-P2A-mCherry BlastR
Plasmid#186740PurposeDox inducible RAB10-T2A-RABIF-P2A-mCherry expression construct cloned into a lentiviral backbone containing a blasticidin resistance geneDepositorUseLentiviralTagsRAB10-T2A-RABIF-P2A-mCherryExpressionMammalianAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
LeGO-iBSD-5LO-d4
Plasmid#182743PurposeLentiviral expression vector for codon-optimized 5-Lipoxygenase (isoform delta 4) in mamallian cells with blasticidin S resistance (bsd).DepositorInsert5-Lipoxygenase isoform delta 4 (ALOX5 Human)
UseCre/Lox and LentiviralExpressionMammalianMutationcodon optimized for expression in homo sapiensPromoterSFFVAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
LeGO-iBSD-5LO-p12
Plasmid#182744PurposeLentiviral expression vector for codon-optimized 5-Lipoxygenase (isoform p12) in mamallian cells with blasticidin S resistance (bsd).DepositorInsert5-Lipoxygenase isoform p12 (ALOX5 Human)
UseCre/Lox and LentiviralExpressionMammalianMutationcodon optimized for expression in homo sapiensPromoterSFFVAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
LeGO-iBSD-5LO-E376Q
Plasmid#182742PurposeLentiviral expression vector for codon-optimized 5-Lipoxygenase (enzymatically inactive E376Q mutant) in mamallian cells with blasticidin S resistance (bsd).DepositorInsert5-Lipoxygenase E376Q (ALOX5 Human)
UseCre/Lox and LentiviralExpressionMammalianMutationenzymatically inactive 5-LO E376Q mutant, codon o…PromoterSFFVAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
LeGO-iBSD-5LO-d13
Plasmid#182745PurposeLentiviral expression vector for codon-optimized 5-Lipoxygenase (isoform delta 13) in mamallian cells with blasticidin S resistance (bsd).DepositorInsert5-Lipoxygenase isoform delta 13 (ALOX5 Human)
UseCre/Lox and LentiviralExpressionMammalianMutationcodon optimized for expression in homo sapiensAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV-Blast
Plasmid#125133PurposeLentiviral empty backbone control vector with CMV promoter and Blasticidin resistance geneDepositorTypeEmpty backboneUseLentiviralAvailable SinceMay 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-EF1adCas9VP64_T2A_MS2p65HSF1-IRESbsdpA
Plasmid#112922PurposeGateway entry vector carrying human EF1a promoter-driven dCas9VP64-T2A-MS2p65HSF1 with Blasticidine resistant markerDepositorInsertEF1a promoter, dCas9VP94, MS2p65HSF1, IRESneo
UseGateway entry vectorExpressionMammalianAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBlastR-GMRWhite
Plasmid#165885PurposeBlasticidin resistance vector with attB and eye marker. Contains an Alpha GB cloning entry point for addition of custom assembly uses blue-white screeningDepositorInsertTransgenesis Ready Selection Vector
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRMCE{BlastR-5FCS-GMRWhite}-Vasa-FC31
Plasmid#165889PurposeBlasticidin resistant FC31 integrase mediated RMCE cassette for upgrading MiMic insertionsDepositorInsertAll-in-one FC31 RMCE Cassette
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pInducer-FRA1
Plasmid#192267PurposeDoxycycline-inducible expression of murine FRA1 (Fosl1)DepositorAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2_3xFLAG_V5_ mmDdx58_V5
Plasmid#160108PurposeExpresses murine Ddx58 in mammalian cellsDepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDEST 3x Flag-pcDNA5-FRT/T0-BRCA1
Plasmid#52504Purposemammalian expression vector of BRCA1 wildtype siRNA resistantDepositorInsertBRCA1 (BRCA1 Human)
TagsFlagExpressionMammalianMutationsiRNA resistant sequence: AGTATAATCPromoterCMVAvailable SinceFeb. 4, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLX304-BCL-XL-Y195F
Plasmid#203573PurposeExpresses V5-tagged BCL-XL with partial drug resistance to A-1331852 in mammalian cells.DepositorInsertBCL2L1 (BCL2L1 Human)
UseLentiviralTagsV5-taggedExpressionMammalianMutationChanged Tyrosine 195 to Phenylalanine for partial…PromoterCMVAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX304-BCL-XL-F97W
Plasmid#203572PurposeExpresses V5-tagged BCL-XL with partial drug resistance to A-1331852 in mammalian cells.DepositorInsertBCL2L1 (BCL2L1 Human)
UseLentiviralTagsV5-taggedExpressionMammalianMutationChanged Phenylalanine 97 to Tryptophan for partia…PromoterCMVAvailable SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX304-BCL-XL-499/500R
Plasmid#203575PurposeExpresses V5-tagged BCL-XL with resistance to shRNA (TRCN0000033499, TRCN0000033500) in mammalian cells.DepositorInsertBCL2L1 (BCL2L1 Human)
UseLentiviralTagsV5-taggedExpressionMammalianMutationsilent point mutations to make resistant shRNA 49…PromoterCMVAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX304-BCL-XL-499R
Plasmid#203574PurposeExpresses V5-tagged BCL-XL with resistance to shRNA (TRCN0000033499) in mammalian cells.DepositorInsertBCL2L1 (BCL2L1 Human)
UseLentiviralTagsV5- taggedExpressionMammalianMutationsilent point mutations introduced to make it resi…PromoterCMVAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMH3
Plasmid#52528Purposeserves as PCR-template to generate HR donors for C-terminal GFP-tagDepositorInserteGFP and Blasticigin resistance cassette
UseBlunt cloning kitAvailable SinceApril 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBlastR-12xLexAOp-mCherry-MiniWhite
Plasmid#165917PurposeBlasticidin resistant 12xLexAOp mCherry Mini-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable LexAOp Response Vector
UseSynthetic BiologyAvailable SinceApril 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hU6-mU6-BlasGO
Plasmid#136906PurposeLentivirus for base editing activatable Blasticidin resistance gene expression in mammalian cells. All in one vector with sgBlasGO.DepositorInsertBlasCyGO
UseLentiviralMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBlastR-5xUAS-sfGFP-GMRWhite
Plasmid#165907PurposeBlasticidin resistant 5xUAS sfGFP GMR-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable UAS Response Vector
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBlastR-5xUAS-sfGFP-MiniWhite
Plasmid#165910PurposeBlasticidin resistant 5xUAS sfGFP Mini-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable UAS Response Vector
UseSynthetic BiologyAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRB20
Plasmid#52559Purposeserves as PCR-template to generate HR donors for C-terminal YFP-tagDepositorInserteYFP and Blasticigin resistance cassette
UseBlunt cloning kitAvailable SinceApril 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
H2B-mScarlet- hMeikin(1-332, E151R, R154E)-mNeonGreen
Plasmid#174715PurposeStable expression of fluorescent Separase cleavage sensor with human Meikin with Separase-resistant mutationsDepositorInsertMeikin
UseRetroviralTagsH2B-mScarlet and mNeonGreenExpressionMammalianMutation1-332, E151R, R154EAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBlastR-5xUAS-mCherry-MiniWhite
Plasmid#165911PurposeBlasticidin resistant 5xUAS mCherry Mini-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable UAS Response Vector
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBlastR-12xLexAOp-EBFP2-MiniWhite
Plasmid#165918PurposeBlasticidin resistant 12xLexAOp EBFP2 Mini-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable LexAOp Response Vector
UseSynthetic BiologyAvailable SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBlastR-5xQUAS-EBFP2-GMRWhite
Plasmid#165921PurposeBlasticidin resistant 5xQUAS EBFP2 GMR-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable QUAS Response Vector
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBlastR-5xQUAS-sfGFP-MiniWhite
Plasmid#165922PurposeBlasticidin resistant 5xQUAS sfGFP Mini-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable QUAS Response Vector
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBlastR-5xQUAS-EBFP2-MiniWhite
Plasmid#165924PurposeBlasticidin resistant 5xQUAS EBFP2 Mini-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable QUAS Response Vector
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBlastR-5xUAS-EBFP2-MiniWhite
Plasmid#165912PurposeBlasticidin resistant 5xUAS EBFP2 Mini-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable UAS Response Vector
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only