We narrowed to 3,505 results for: cgas
-
Plasmid#156180PurposeCMV-driven expression of sgRNA-resistant SLC38A2 wild-type cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA se…PromoterCMVAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMini-CMV-NLS-dead R-IscB-NLS_T2A_mCherry_U1a-EGFP trans-splicing ωRNA
Plasmid#246436PurposeExpresses R-IscB with EGFP-repairing ωRNA in mammalian cells for trans-splicing assessments.DepositorInsertsO.gue IscB with dead mutations (D60A, H269A) and delta-TID
mCherry
ωRNA with trans-splicing template
TagsGFP N-terminal sequence (M1 to Q95), Hemi Intron …ExpressionMammalianMutationGFP N-terminal sequence M1 to Glutamine 95 append…PromoterCMV and U1aAvailable SinceOct. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mTubb3
Plasmid#87116PurposeAAV backbone plasmid including GFP knock-in donor and Tubb3gRNA for HITIDepositorInsertU6-mTubb3sgRNA-GFP-EF1a-mCherryKASH-hGHpA
UseAAV and CRISPRAvailable SinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOTTC763 - pX458 with rat Rosa26 gRNA A
Plasmid#113161PurposeA plasmid that expresses a guide RNA targeting rat Rosa26 as well as FLAG-tagged SpCas9 and GFPDepositorInsertgRNA for rat Rosa26
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-Axin1
Plasmid#162543PurposesgRNA targeting Axin1DepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Neurog2 x2)
Plasmid#171100PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Neurog2.DepositorAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PRKCG
Plasmid#23640DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA2
Plasmid#99735PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-4
Plasmid#118022PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
ATM gRNA (BRDN0001146099)
Plasmid#77530Purpose3rd generation lentiviral gRNA plasmid targeting human ATMDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA4(15))-PGKpuro2ABFP-W
Plasmid#200462PurposeLentiviral vector expressing gRNA targeting human SMARCA4DepositorInsertSMARCA4(15) (SMARCA4 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR-53BP1 1-1972 28A
Plasmid#53447PurposeRecombinational donor/master vectorDepositorInsert53BP1 (TP53BP1 Human)
UseGatewayMutationI914T mutation; All 28 SQ/TQ motifs in N-term of …Available SinceDec. 10, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKLV2-U6gRNA5(JARID2_5-4)-PGKpuroBFP-W
Plasmid#211966PurposeExpress gRNA against JARID2 with puro and BFPDepositorInsertsgRNA targeting JARID2 (JARID2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
MAGI1 gRNA (BRDN0001146934)
Plasmid#78069Purpose3rd generation lentiviral gRNA plasmid targeting human MAGI1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y2B)-PGKpuro2AmCherry-W
Plasmid#163179PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FCGRT-Fc(DAPA)-AviTag-6xHis
Plasmid#156820PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertFCGRT (FCGRT Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FCGRT-COMP5AP-AviTag-9xHis
Plasmid#157384PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W1K)-PGKpuro2AmCherry-W
Plasmid#163176PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-3
Plasmid#223224Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-HEK3-CTTins-px330-scaffold
Plasmid#180017PurposeTransiently expressing a pegRNA to introduce HEK3 CTT insertion in human cells. It has a sgRNA scaffold from px330.DepositorInsertPrime editing pegRNA for HEK3-CTTins, with px330 scaffold (EPHA8 Synthetic)
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FCGR3B-Fc(DAPA)-AviTag-6xHis
Plasmid#156579PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertFCGR3B (FCGR2B Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2-shATRX
Plasmid#124258PurposeExpresses shRNA targeting ATRX. Construct has inverted repeats to be used in Sleeping beauty system.DepositorInsertshATRX
ExpressionMammalianAvailable SinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458-CCND1
Plasmid#172630PurposeExpresses a gRNA against CCND1 and Cas9 from S. pyogenes with 2A-EGFPDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
PRKDC gRNA (BRDN0001145772)
Plasmid#77862Purpose3rd generation lentiviral gRNA plasmid targeting human PRKDCDepositorAvailable SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-LRRK2-G2019S-3a
Plasmid#180432PurposeTransiently expressing a pegRNA to introduce LRRK2-G2019S mutation in human cellsDepositorInsertncRNA targeting LRRK2-G2019S (LRRK2 Human)
UseCRISPRExpressionMammalianMutationLRRK2-G2019SPromoterU6Available SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FCGR2B-Fc(DAPA)-AviTag-6xHis
Plasmid#156573PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertFCGR2B (FCGR2B Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
shERK1a-mlpx-puro
Plasmid#65228Purposeencodes a shRNA against ERK1DepositorInsertshRNA against ERK2 (MAPK1 Human)
ExpressionMammalianAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
B52 + CHEK2 sgSTOP
Plasmid#100712PurposeB52 plasmid expressing CHEK2 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting CHEK2 (cloned using BbsI) (CHEK2 Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W2B)-PGKpuro2AmCherry-W
Plasmid#163177PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of mCherry tagDepositorAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
B52 + FANCM sgSTOP
Plasmid#100710PurposeB52 plasmid expressing FANCM sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting FANCM (cloned using BbsI) (FANCM Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgCRY1
Plasmid#176511PurposeExpresses sgRNA in mammalian cellsDepositorAvailable SinceJan. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 Luciferase
Plasmid#117072Purposesingle guide RNA targeting LuciferaseDepositorInsertLuciferase
UseCRISPRPromoterhU6Available SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pInducer20_SLC38A2_wt
Plasmid#156182PurposeDox-inducible expression of sgRNA-resistant SLC38A2 wild-type cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterTREAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y2B)-PGKpuro2ABFP-W
Plasmid#163178PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of BFP tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgArid2#2/Cre
Plasmid#173576PurposeExpresses a Arid2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Arid2 (Arid2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-8
Plasmid#129048Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA8 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA8 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ikaros-CRISPR-Nick2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75243PurposeCRISPR/Cas9 NICKASE plasmid against human Ikaros (2/2)DepositorInsertsgRNA against human Ikaros (IKZF1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
HK2 gRNA (BRDN0001162355)
Plasmid#76311Purpose3rd generation lentiviral gRNA plasmid targeting human HK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMVblast_SLC38A2_N82A
Plasmid#156181PurposeCMV-driven expression of sgRNA-resistant SLC38A2 N82A mutant cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterCMVAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only