We narrowed to 7,612 results for: Trac
-
Plasmid#98398PurposeLentivirus for expression of non-targeting control shRNA (Dox-inducible)DepositorInsertnon-targeting randomized sequence
UseLentiviralAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
(attB) tdMCP-tagged BRaf with MS2-circRNA
Plasmid#226163PurposeUsed to integrate 3xFlag-tdMCP-BRaf and MS2-circRNA barcodes into RNA-Protein Landing Pad cell linesDepositorInsertsUseBxb1 attb, no promoterTags3xFlag-tdMCPExpressionMammalianAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-N1 GBP (GBP-mCherry)
Plasmid#162879PurposeExpression in mammalian cells of GFP binding protein (GBP) tagged with mCherryDepositorInsertGFP Binding Protein
TagsmCherryExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
5` CC: Puro – loxP – GFP-C
Plasmid#219563Purpose5` circularization cassette.Used in combination with one of the 3' circularization cassettes to induce Cre-mediated circularizazion or inversion of a desired genomic region.DepositorInserthPGK-promoter_PuroR_2A_loxP_GFP-C
UseUnspecifiedPromoterhPGKAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
PL-5LTR-RGR(DMD#1)-AmCyan-A
Plasmid#138482PurposeExpresses sgRNA targeting human DMD (Dystrophin) for packaging into NanoMEDIC particle.DepositorInsertRibozyme-flanked gRNA and AmCyan
UseCRISPRExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
3` CC: Hygro – GFP-N – loxP – mScarlet
Plasmid#219564Purpose3` circularization cassette.To induce Cre-mediated circularization or inversion of a genomic region with concomitant GFP reconstitution and mScarlet expression from the chromosomeDepositorInsert3` CC: Hygro – GFP-N – loxP – mScarlet
UseUnspecifiedPromoterEF1-aAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-IDH2-R172K-FLAG
Plasmid#66807PurposeTet-inducible expression of mutant IDH2 in mammalian cellsDepositorInsertIDH2 (IDH2 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationR172KPromoterCMVAvailable SinceFeb. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
InsRA-eGFP
Plasmid#79795PurposeInsulin receptor isoform A with a inter-domain eGFP tag at extracellular region (between furin-like domain and transmembrane domain). For imaging insulin receptor trafficing.DepositorAvailable SinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Cas9-T2A-TdT
Plasmid#126424PurposeExpresses Cas9-T2A-TdT in mammalian cells. (pTBL209)DepositorAvailable SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
PLL5.0-Anillin ShRNA-Cherry-AnillinFL
Plasmid#187271PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin full lengthDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryPromoterU6, CMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-E-NoMi-P2A-CopGFP-T2A-PuroR
Plasmid#207805PurposeE-NoMi is a re-engineered tetraspanin scaffold tagged with bioluminescent and fluorescent reporter proteins under an EF-1α promoter.DepositorInsertE-NoMi
UseLentiviralTags3xFlag tag, copGFP, mCherry, and nanoluciferaseExpressionMammalianPromoterEF-1alphaAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
(attB) tdMCP-tagged BRaf
Plasmid#226165PurposeUsed to integrate 3xFlag-tdMCP-BRaf without MS2-circRNA barcdes into landing pad cell lines containing a single promoter.DepositorInsert3xFlag-tdMCP-BRaf (BRAF Human)
UseBxb1 attb, no promoterTags3xFlag-tdMCP and IRES-mCherry-P2A-PuroRExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma9-GFP2
Plasmid#140991PurposeEncodes a G gamma subunit (GNG9) containing GFP2 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma12-GFP2
Plasmid#166781PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma12-GFP2 (GNG12 Human, Synthetic)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma13-GFP2
Plasmid#140992PurposeEncodes a G gamma subunit (GNG13) containing GFP2 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma3-GFP2
Plasmid#166775PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma3-GFP2 (GNG3 Human, Synthetic)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma7-GFP2
Plasmid#166778PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma7-GFP2 (GNG7 Human, Synthetic)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma11-GFP2
Plasmid#166780PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma11-GFP2 (GNG11 Human, Synthetic)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTT3 Flrt2-myc
Plasmid#72192PurposeExpress full-length Flrt2with a C-terminal myc tagDepositorAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-FRT-stop-FRT(FSF)- loxP-stop-loxP(LSL)-SP-HA-HRPtm-WPRE-bGHpolyA
Plasmid#197044PurposeIn situ cell-surface proteome extraction by extracellular labeling (iPEEL)DepositorInsertspCAG-FSF-LSL
SP-HA-HRPtm
WPRE-bGHpolyA
TagsHA, mycExpressionMammalianPromoterpCAGAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-ACE2
Plasmid#141185PurposeMammalian expression plasmid for human ACE2 with an N-terminal (extracellular) c-myc tagDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianPromoterCMVAvailable SinceApril 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-CMV-hXRCC1-mCherry-Hygro
Plasmid#176532PurposemCherry fused to the C-terminus of XRCC1 & a hygromycin resistance cassetteDepositorInsertX-Ray Repair Cross Complementing 1 (XRCC1 Human)
UseLentiviralTagsmCherryExpressionMammalianPromoterCMVAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pL(EF1a-phi-AQP1-FKBP12DD-IRES-EGFP-WPRE)
Plasmid#236279PurposeLentiviral vector that can express hAqp1 with fkbp12 degron in mammalian cells. EF1a promoter. EGFP marker.DepositorInserthuman aquaporin 1 (AQP1 Human)
UseLentiviralTagsFlag and fkbp12ExpressionMammalianPromoterEF1aAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459v3-eSpCas9(1.1)
Plasmid#178800PurposeHigh-fidelity eSpCas9(1.1) with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV.EF1α.mEmerald.CD9.miR9T
Plasmid#170452PurposeLentiviral plasmid that encodes mEmerald-CD9 fusion protein with microRNA 9 tandem cassette to restrict expression to microglia with EF1-alpha promoter.DepositorAvailable SinceMay 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFPC2-Gephyrin P1
Plasmid#68815Purposeexpression of fluorescent tagged Geph in mammalian cellsDepositorInsertGephyrin (Gphn Rat)
TagsEGFPExpressionMammalianMutationsilent mutations on internal EcoRI site. Gephyri…PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D-flag-mAdrb1-WPRE
Plasmid#223671PurposeAAV expression of flag-mAdrb1 from GfaABC1D promoterDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL A WT
Plasmid#202413PurposeExpression of GFP-tagged PODXL (isoform A) WTDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA CFP hNKCC1 WT (NT15-H)
Plasmid#49077PurposeExpresses human NKCC1 with an N-terminal 3xHA-CFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites. Native hNKCC1 amino acid sequenceDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x HA and mCeruleanExpressionMammalianMutation262 silent mutations from native hNKCC1PromoterCMVAvailable SinceNov. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHLS-EF1a-FKBP12-Gag(HIV)
Plasmid#138476PurposeExpresses FKBP12 fused Gag for packaging FRB-SpCas9 into NanoMEDIC particle.DepositorInsertHIV Gag
TagsFRBP12 and Lynn Myristolation siteExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-VSV
Plasmid#242781PurposeAAV transfer plasmid expressing eGFP-VSV under a CAG promoter.DepositorInsertEGFP
UseAAVTagsVSV G tagPromoterCAGAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
LV-Sox10MCS5-GFP-EF1a-mCherry
Plasmid#115782PurposeSox10-MCS5-GFP and a constitutive EF1α-mCherry reporter plasmid. Construct generates constitutive red fluorescence and basal promoter cfos conjugated SOXMCS5 enhancer driven GFP expression in a cell.DepositorInsertsmouse derived SOX10 Multiple Species Conserved enhancer element 5 conjugated with cfos basal promoter
EF1alpha promoter driven constitutive mCherry
UseLentiviralTagsEF1α promoter fused to mCherry and cfos promoter …PromoterSOX10 Multiple Species Conserved enhancer element…Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
SuExp His-Myc-hPLD3
Plasmid#173851PurposeProtein expression plasmid for recombinant His-Myc tag human PLD3DepositorInsertPLD3 (PLD3 Human)
Tags6xHis, Myc, Factor X cleavableExpressionMammalianMutationintracellular and transmembrane domain truncated,…PromoterCMVAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
UPRT-mCh-Nluc-P2A-neo-UPRT
Plasmid#135015PurposeExpresses mCherry protein and a fusion protein of Nluc-neo inserting into Cryptosporidium parvum UPRT locusDepositorInsertsmCh-Nluc-P2A-neo
UPRT 5'UTR
UPRT 3'UTR
UseCryptosporidium expressionTagsmCherry and Nluc-neoPromoterCryptosporidium actin and enolaseAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
CIBN-GFP-Sec61B
Plasmid#104177PurposeExpresses fusion of CIB1 (1-170) with GFP and Sec61BDepositorAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL B WT
Plasmid#202414PurposeExpression of GFP-tagged PODXL (isoform B) WTDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
SuExp His-Myc-hPLD4
Plasmid#173852PurposeProtein expression plasmid for recombinant His-Myc tag human PLD4DepositorInsertPLD4 (PLD4 Human)
Tags6xHis, Myc, Factor X cleavableExpressionMammalianMutationintracellular and transmembrane domain truncated,…PromoterCMVAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only