We narrowed to 5,335 results for: PID;
-
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1h
Plasmid#113050Purposeexpress the genetically-encoded fluorescent dopamine(DA) sensor GRAB_DA1h in neuronsDepositorHas ServiceAAV Retrograde and AAV9InsertGPCR activation based DA sensor GRAB_DA1h (DRD2 Human)
UseAAVPromoterhSynAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-PSMD2
Plasmid#161917PurposeExpresses human PSMD2 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorInsert26S proteasome non-ATPase regulatory subunit 2 (PSMD2 Human)
TagsGFP-FLAGExpressionMammalianPromoterCMVAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pETM6-G6-vioABE-4A6-vioC-3A2-vioD
Plasmid#73440PurposeViolacein pathway (vioABECD) in monocistronic configuration, transcriptionally driven by orthogonal T7-lac promoter variants G6 (vioABE), 4A6 (vioC), and 3A2 (vioD) for orthogonal flux redirection.DepositorInsertPG6-vioABE-P4A6-vioC-P3A2-vioD
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPG6, P4A6, and P3A2 (orthogonal T7-lac variants)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-JEDI-2P-WPRE
Plasmid#179464PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for neuron -specific expression using the promoter hSynDepositorHas ServiceAAV9InsertJEDI-2P
UseAAVExpressionMammalianPromoterhSynAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_6P-D614G
Plasmid#172734PurposeExpression vector for SARS-CoV-2 (HexaPro-D614G) spike used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
Tags3X-FLAG; Strep-Tag II; HRV 3C cut site; PDGFR-B T…ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterCMVAvailable SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCag FlpO-2A-Cre EV
Plasmid#129419Purposeepisomal expression of FlpO and Cre recombinasesDepositorInsertFlpO-2A-Cre
UseCre/Lox and Unspecified; Episomal expression vect…ExpressionMammalianPromoterCMV/Chick β-actin (CAG)Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIG-701pUC19-tNGFR-P2A-FOXP3
Plasmid#186114PurposeKnockin of truncated NGFR to target geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti NLuc398-hLGALS8 IRES hCALCOCO2-CLuc394
Plasmid#128387PurposeExpresses a split firefly luciferase reporter based on the full length, human Gal8 and CALCOCO2, which interact following endosomal disruptionDepositorUseLentiviral, Luciferase, and Synthetic BiologyTagsCLuc394 and NLuc398ExpressionMammalianPromoterEFS and IRESAvailable SinceJan. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHA TST 3C SMO EABR
Plasmid#234989PurposeFor production of Extracellular Vesicles (EVs), with the receptor Smoothened (Smo), Twin-Strep-tag (TST), and an HA tag at its N-terminus on their surfaceDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPICZc-HsACTB*-thymosinB-8His
Plasmid#111146PurposeExpresses human beta-actin fused with thymosin beta and a His tag.DepositorInsertACTB (ACTB Human)
UsePichia pastoris integrationTagsThymosin beta and a His-tagExpressionYeastPromoterAOX1Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5_miniTurbo-C12orf49
Plasmid#155111Purposetransfection plasmid for the exogneous expression of N-terminal miniTurbo-tagged C12orf49 for generation of FlpIn cell lines for BioIDDepositorInsertC12orf49 (SPRING1 Human)
TagsminiTurboExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPICZc-HsACTG1*-thymosinB-8His
Plasmid#111147PurposeExpresses human gamma-actin (codon is optimised for expression in Pichia pastoris) fused with thymosin beta and a His tag.DepositorInsertactin gamma 1 (ACTG1 Human)
UsePichia pastoris integration vectorTagsThymosin beta and a His-tagExpressionYeastMutationcodon-optimised for expression in Pichia pastorisPromoterAOX1Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1m
Plasmid#113049Purposeexpress the genetically-encoded fluorescent dopamine(DA) sensor GRAB_DA1m in neuronsDepositorHas ServiceAAV9InsertGPCR activation based DA sensor GRAB_DA1m (DRD2 Human)
UseAAVPromoterhSynAvailable SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-JEDI-2P-WPRE
Plasmid#179460PurposeDouble floxed genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector under the control of the mammalian promoter (EF1a)DepositorHas ServiceAAV1InsertJEDI-2P
UseAAV and Cre/LoxExpressionMammalianPromoterEF1aAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-kappa-myc-dL5-2xG4S-TMst
Plasmid#73206PurposeExpresses myc-dL5(E52D)-TM (PDGFR derived) on the surface of mammalian cells, with an Igk-leader. (MBIC5, dL5**, FAP)DepositorInsertkappa-myc-dL5-2XG4S-TM (MYC Human)
TagsThe FAP is fused with 2 copies of a G4S linker an…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable SinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-NLS-myc-dL5-2xG4S-mCer3
Plasmid#73205PurposeExpresses myc-dL5(E52D)-mCer3 fusion protein in nuclei of mammalian cells. (MBIC5, dL5**, FAP)DepositorInsertNLS-myc-dL5-2XG4S-mCer3 (MYC Synthetic, Human)
TagsThe FAP and mCerulean3 are fused with 2 copies of…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable SinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-sgRab18.N-Cas9-T2A-mCherry-P2A-Puro
Plasmid#129418PurposeEncoding Cas9 and sgRAB18.N for CRISPR/Cas9 mediated HDR tagging of endogenous human RAB18 N-terminusDepositorInsertSpCas9 and sgRAB18.N (RAB18 Human)
UseCRISPRTagsT2A-mCherry-P2A-PuroExpressionMammalianPromoterhU6Available SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
LgBiT-hACE2
Plasmid#173431Purposeprotein expression plasmid of LgBiT-hACE2-IgG1 FcDepositorAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-COXIV-COX8-dL5-2XG4S-mCer3
Plasmid#73208PurposeExpresses dL5(E52D)-mCer3 fusion protein in mitochondria of mammalian cells. (MBIC5, dL5**, FAP)DepositorInsertCOXIV-COX8-dL5-2XG4S-mCer3 (COX8A Synthetic, Human)
TagsThe FAP and mCerulean3 are fused with 2 copies of…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable SinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE
Plasmid#179459PurposeDouble floxed soma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector expressed under the mammalian promoter (EF1a)DepositorHas ServiceAAV1InsertJEDI-2P-Kv
UseAAV and Cre/LoxExpressionMammalianPromoterEF1aAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-JEDI-2P-Kv-WPRE
Plasmid#179463PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for neuron -specific expression using the promoter hSynDepositorHas ServiceAAV9InsertJEDI-2P-Kv
UseAAVExpressionMammalianPromoterhSynAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pE-N1-RDH11
Plasmid#161916PurposeExpresses untagged human RDH11. Confers G418 resistance.DepositorAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-JEDI-2P-Kv-WPRE
Plasmid#179465PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for expression in excitatory glutamatergic neurons using the promoter CaMKIIDepositorInsertJEDI-2P-Kv
UseAAVExpressionMammalianPromoterCaMKIIaAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-JEDI-2P-WPRE
Plasmid#179469PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for astrocytes specific expression using the promoter GFAPDepositorInsertJEDI-2P
UseAAVExpressionMammalianPromoterGFAPAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/Puro-CAG-JEDI-2P-Kv
Plasmid#179462PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P expressed under strong mammalian promoter (CAG)DepositorInsertJEDI-2P-Kv
ExpressionMammalianPromoterCAGAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
KHC068 BRD2-KI-GFP-2A-L387A
Plasmid#231713PurposeCRISPR mediated KI of BromoTag at N-terminus of BRD2-GFP-P2A-BromoTag, works well with KHC064 and KHC065DepositorAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAD-CMV-Caveolin1-CMV-GFP
Plasmid#83272PurposeAdenoviral expression of Caveolin1 with co-expression of GFPDepositorAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-JEDI-2P-WPRE
Plasmid#179466PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for expression in excitatory glutamatergic neurons using the promoter CaMKIIDepositorInsertJEDI-2P
UseAAVExpressionMammalianPromoterCaMKIIaAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Flag_HsIRE1a_deltaP29_D408_K599A_pBabePuro
Plasmid#58492Purposeretroviral pBabe puro vector encoding N-terminally FLAG tagged mutant human IRE1a deleted from amino acids P28 to D408 and bearing mutation K599A (kinase domain mutant)DepositorInsertIRE1a (ERN1 Human)
UseRetroviralTagsFLAG and preprotrypsin signal sequenceExpressionMammalianMutationdeleted amino acids P29 to D408 and bearing mutat…Available SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5_C12orf49-miniTurbo
Plasmid#155112Purposetransfection plasmid for the exogneous expression of C-terminal miniTurbo-tagged C12orf49 for generation of FlpIn cell lines for BioIDDepositorInsertC12orf49 (SPRING1 Human)
Tags3x Flag and miniTurboExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyso-PTEN(A4)-mCherry
Plasmid#184054PurposeLysosome-targeted constitutively active mutant of phosphatase and tensin homolog (PTEN); tagged with mCherry.DepositorInsertLyso-PTEN(A4)-mCherry (PTEN Human)
TagsLysosome-associated membrane protein 1 (LAMP1). a…ExpressionMammalianMutationSer 380/385 and Thr 382/383 in PTEN mutated to Al…PromoterCMVAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-kappa-myc-dL5-2XG4S-mCer3-KDEL
Plasmid#73209PurposeExpresses myc-dL5(E52D)-mCer3 fusion protein in endoplasmic reticulum of mammalian cells with an Igk-leader. (MBIC5, dL5**, FAP)DepositorInsertkappa-myc-dL5-2XG4S-mCer3-KDEL (MYC Synthetic, Human)
TagsThe FAP and mCerulean3 are fused with 2 copies of…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable SinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiMutB3GALT5catdead-blast
Plasmid#220869Purposelentiviral vector for expressing human B3GALT5 with D156A and D243A inactivating mutations and C-terminal myc-DDK tag, includes nucleotide change in PAM targeting sequenceDepositorInsertbeta-1,3-galactosyltransferase 5 (B3GALT5 Human)
UseLentiviralTagsmyc, FLAGExpressionMammalianMutationencodes D156A and D243A mutations; also, nucleoti…Available SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTU1-A-fba_RiboJ_GFP+_MGApt_Bba_B0015
Plasmid#107582PurposeB. megaterium DSM319 fba promoter, GFP+ with malachite green mRNA aptamer for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)DepositorInsertGFP+
UseSynthetic Biology; E. coli and bacillus shuttle v…TagsB. megaterium DSM319 xylA leader sequence (MTSSKI…ExpressionBacterialMutationF64L/ S65T/ Q80R/ F99S/ M153T/ V163APromoterfba promoter Bacillus megaterium DSM319Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyso-INPP4B-mCherry
Plasmid#184055PurposeLysosome targeted inositol polyphosphate-4-phosphatase type II B; tagged with mCherry.DepositorTagsLysosome-associated membrane protein 1 (LAMP1). a…ExpressionMammalianPromoterCMVAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pExp-RBD-CHis
Plasmid#195002PurposeProduction of SARS-CoV2 receptor binding domain in E. coli with C-terminal Avi-tagDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETM30-ARC105
Plasmid#133426PurposeHuman ARC105 coding sequence in vector for in vitro transcription and protein expression, with T7 promoter.DepositorInsertPCQAP (MED15 Human)
ExpressionBacterialMutationContains amino acids 5-78 fused to C-terminal of …Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_Part 2 Spacer
Plasmid#172730PurposeEncodes Part 2 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGL3-sgACSL3.C-Cas9-P2A-Puro
Plasmid#129412PurposeEncoding Cas9 and sgACSL3.C for CRISPR/Cas9 mediated HDR tagging of endogenous human ACSL3 C-terminusDepositorInsertSpCas9 and sgACSL3.C (ACSL3 Human)
UseCRISPRTagsP2A-PuroExpressionMammalianPromoterhU6Available SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPICZc-Ub-R-HsACTB*-thymosinB-8His
Plasmid#111149PurposeExpresses arginylated human beta-actin fused with thymosin beta and a His tag.DepositorInsertACTB (ACTB Human)
UsePichia pastoris integration plasmidTagsThymosin beta and a His-tagExpressionYeastMutationN-terminal arginylationPromoterAOX1Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2TK-arc105
Plasmid#133425PurposeHuman ARC105 coding sequence in vector for bacterial expression of GST fusion protein.DepositorInsertPCQAP (MED15 Human)
ExpressionBacterialMutationContains amino acids 1-95 or ARC105 fused to the …Available SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-ACSL3-sfGFP(C) HDR template
Plasmid#129413PurposeHDR tempalte for tagging of endogenous human ACSL3 C-terminus with sfGFPDepositorInsertACSL3 HDR template (ACSL3 Human)
UseCRISPR and TALEN; Endogenous tagging hdr templateTagssfGFPExpressionMammalianAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
Flag_MmPERK_S503_N1114_pBabePuro
Plasmid#58423Purposeretroviral pBabe puro vector encoding N-terminally FLAG tagged mutant mouse PERK deleted from amino acids M1 to Y502. The remaining amino acids are S503 to N1114.DepositorInsertPERK (Eif2ak3 Mouse)
UseRetroviralTagsFLAG and preprotrypsin signal sequenceExpressionMammalianMutationDeleted amino acids M1 to Y502Available SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-TK1
Plasmid#161919PurposeExpresses human TK1 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
dopamine beta hydroxylase (dbh)_L (OZ525)
Plasmid#27200DepositorInsertZinc finger array targeting dbh (dbh Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
Swachmann-Bodian-Diamond Syndrome Gene, sbds_R (OZ546)
Plasmid#28071DepositorInsertZinc finger array targeting Swachmann-Bodian-Diamond Syndrome Gene, sbds (sbds Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
Swachmann-Bodian-Diamond Syndrome Gene, sbds_L (OZ545)
Plasmid#28070DepositorInsertZinc finger array targeting Swachmann-Bodian-Diamond Syndrome Gene, sbds (sbds Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
cftr_R (OZ518)
Plasmid#27193DepositorInsertZinc finger array targeting cftr (cftr Zebrafish)
UseZebrafish targetingAvailable SinceJan. 25, 2011AvailabilityAcademic Institutions and Nonprofits only