We narrowed to 11,169 results for: ENA
-
Plasmid#190543PurposeMammalian Expression of Shank2 scFV. Derived from hybridoma N23B/6.DepositorInsertShank2 (Rattus norvegicus) recombinant scFV (Shank2 Mouse)
UseTagsHA, Sortase, 6xHisExpressionMammalianMutationPromoterCMVAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Rufy3 scFv [N483/84]
Plasmid#190559PurposeMammalian Expression of Rufy3 scFV. Derived from hybridoma N483/84.DepositorInsertRufy3 (Mus musculus) recombinant scFV (Rufy3 Mouse)
UseTagsHA, Sortase, 6xHisExpressionMammalianMutationPromoterCMVAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBGE2.0
Plasmid#165987PurposeMulti-host shuttle vector that can be transferred by conjugation and replicate in S. meliloti, E. coli, S. cerevisiae, and P. tricornutum. Contains S. meliloti pSymB origin and Tet resistance.DepositorInsertsRK2/RP4 origin of transfer
repA1B1C1
nourseothricin N-acetyl transferase
tetracycline resistance
UseSynthetic Biology; Bacterial and yeast cloning; c…TagsExpressionMutationPromoterAvailable sinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAGE3.0
Plasmid#165985PurposeMulti-host shuttle vector that can be transferred by conjugation and replicate in S. meliloti, E. coli, S. cerevisiae, and P. tricornutum. Contains S. meliloti pSymA origin and Nm/Kan resistance.DepositorInsertsRK2/RP4 origin of transfer
repA2B2C2
nourseothricin N-acetyl transferase
neomycin resistance
UseSynthetic Biology; Bacterial and yeast cloning; c…TagsExpressionMutationPromoterAvailable sinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIFEX-A2aGH
Plasmid#160542PurposepITY4 derivative reporter plasmid encoding Ashbya gossypii PTEF1-Saccharomyces cerevisiae FEX1-MFaT; as well as PGAL1-Homo sapiens ADORA2A-EGFP-10HIS-MFaT.DepositorInsertUseTagsExpressionYeastMutationN/APromoterAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEFEX1-A2aGH
Plasmid#160543PurposepYES2 derivative reporter plasmid encoding Ashbya gossypii PTEF1-Saccharomyces cerevisiae FEX1-MFaT; as well as PGAL1-Homo sapiens ADORA2A-EGFP-10HIS-MFaT.DepositorInsertUseTagsExpressionYeastMutationN/APromoterAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEFEX2-A2aGH
Plasmid#160544PurposepYES2 derivative reporter plasmid encoding PPGI1-Saccharomyces cerevisiae FEX1-MFaT; as well as PGAL1-Homo sapiens ADORA2A-EGFP-10HIS-MFaT.DepositorInsertUseTagsExpressionYeastMutationN/APromoterAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEFEX3-A2aGH
Plasmid#160545PurposepYES2 derivative reporter plasmid encoding PREV1-Saccharomyces cerevisiae FEX1-MFaT; as well as PGAL1-Homo sapiens ADORA2A-EGFP-10HIS-MFaT.DepositorInsertUseTagsExpressionYeastMutationN/APromoterAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFEX1-A2aGH
Plasmid#160546PurposepYC2/CT derivative reporter plasmid encoding Ashbya gossypii PTEF1-Saccharomyces cerevisiae FEX1-MFaT; as well as PGAL1-Homo sapiens ADORA2A-EGFP-10HIS-MFaT.DepositorInsertUseTagsExpressionYeastMutationN/APromoterAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFEX2-A2aGH
Plasmid#160547PurposepYC2/CT derivative reporter plasmid encoding PPGI1-Saccharomyces cerevisiae FEX1-MFaT; as well as PGAL1-Homo sapiens ADORA2A-EGFP-10HIS-MFaT.DepositorInsertUseTagsExpressionYeastMutationN/APromoterAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFEX3-A2aGH
Plasmid#160548PurposepYC2/CT derivative reporter plasmid encoding PREV1-Saccharomyces cerevisiae FEX1-MFaT; as well as PGAL1-Homo sapiens ADORA2A-EGFP-10HIS-MFaT.DepositorInsertUseTagsExpressionYeastMutationN/APromoterAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-SAPAP1/2 [N238/31R]
Plasmid#182110PurposeMammalian Expression Plasmid of anti-SAPAP1/2 (). Derived from hybridoma N238/31.DepositorInsertanti-SAPAP1/2 () recombinant mouse monoclonal antibody
UseTagsExpressionMammalianMutationPromoterDual CMVAvailable sinceAug. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
mitoTALECD for_atp1_1397NC
Plasmid#186204PurposeFor genome editing (base editing) of Arabidopsis mitochondria, targeted C of RNA editing site of ATP1 by OTP87DepositorInsertsmitochondrial targeted TALE left hand with 1397N of Cytidine Deaminase (mitoTALECD)
mitochondrial targeted TALE right hand with 1397C of Cytidine Deaminase (mitoTALECD)
UseSynthetic Biology; Ti plasmid for plant transform…TagsExpressionMutationPromoterArabidopsis RPS5AAvailable sinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
mitoTALECD for_-20G_1333CN
Plasmid#186200PurposeFor genome editing (base editing) of Arabidopsis mitochondria, targeted 20th G to A of RNA editing site of ATP1 by OTP87DepositorInsertsmitochondrial targeted TALE left hand with 1333C of Cytidine Deaminase (mitoTALECD)
mitochondrial targeted TALE right hand with 1333N of Cytidine Deaminase (mitoTALECD)
UseSynthetic Biology; Ti plasmid for plant transform…TagsExpressionMutationPromoterAvailable sinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
mitoTALECD for_ -13G_1397CN
Plasmid#186199PurposeFor genome editing (base editing) of Arabidopsis mitochondria, targeted -13th G to A of RNA editing site of ATP1 by OTP87DepositorInsertsmitochondrial targeted TALE left hand with 1397C of Cytidine Deaminase (mitoTALECD)
mitochondrial targeted TALE right hand with 1397N of Cytidine Deaminase (mitoTALECD)
UseSynthetic Biology; Ti plasmid for plant transform…TagsExpressionMutationPromoterAvailable sinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
mitoTALECD for_ -6G_1333CN
Plasmid#186198PurposeFor genome editing (base editing) of Arabidopsis mitochondria, targeted -6th G to A of RNA editing site of ATP1 by OTP87DepositorInsertsmitochondrial targeted TALE left hand with 1333C of Cytidine Deaminase (mitoTALECD)
mitochondrial targeted TALE right hand with 1333N of Cytidine Deaminase (mitoTALECD)
UseSynthetic Biology; Ti plasmid for plant transform…TagsExpressionMutationPromoterAvailable sinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET15b MOSPD2 [315-445]
Plasmid#186474PurposeExpression of human MOSPD2 (MSP domain from residue 315 to 445), fused to a cleavable 6HIS tag, in bacteriaDepositorInsertMOSPD2 motile sperm domain containing 2 (MOSPD2 Human)
UseTags6HISExpressionBacterialMutationMSP domain [315-445]PromoterAvailable sinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-shRIIα-RIIαS97A-IRES-EGFP
Plasmid#183457PurposeReplacement of endogenous rat PKA-RIIα subunits with the RIIα S97A variantDepositorInsertsgRNA and Prkar2a (Prkar2a Rat)
UseLentiviralTagsExpressionMutationshRNA-resistant mutations: C135>G, G138>A, …PromotershRNA: H1 / gene: ubiquitinAvailable sinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-shRIIα-RIIαS97E-IRES-EGFP
Plasmid#183458PurposeReplacement of endogenous rat PKA-RIIα subunits with the RIIα S97E variantDepositorInsertsgRNA and Prkar2a (Prkar2a Rat)
UseLentiviralTagsExpressionMutationshRNA-resistant mutations: C135>G, G138>A, …PromotershRNA: H1 / gene: ubiquitinAvailable sinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
Parvalbumin scFv [L114/81]
Plasmid#182073PurposeMammalian Expression of Parvalbumin scFv. Derived from hybridoma L114/81.DepositorInsertrecombinant mouse scFv targeting Parvalbumin (Rattus norvegicus) (Pvalb Mouse)
UseTagsHA, HisExpressionMammalianMutationPromoterCMVAvailable sinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-R21E_B
Plasmid#145997PurposeInsect Expression of DmTral-R21EDepositorInsertDmTral-R21E (tral Fly)
UseTagsExpressionInsectMutationthree silent mutations A198C, A387G, A1437G and 4…PromoterAvailable sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-R42E_B
Plasmid#145998PurposeInsect Expression of DmTral-R42EDepositorInsertDmTral-R42E (tral Fly)
UseTagsExpressionInsectMutationthree silent mutations A198C, A387G, A1437G and 4…PromoterAvailable sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-E23K_B
Plasmid#145989PurposeInsect Expression of DmTral-E23KDepositorInsertDmTral-E23K (tral Fly)
UseTagsExpressionInsectMutationthree silent mutations A198C, A387G, A1437G and 4…PromoterAvailable sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral_99-393-V5His6_D
Plasmid#146137PurposeInsect Expression of DmTral_99-393DepositorInsertDmTral_99-393 (tral Fly)
UseTagsExpressionInsectMutationthree silent mutations A198C, A387G, A1437G and 4…PromoterAvailable sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral_394-543-V5His6_D
Plasmid#146138PurposeInsect Expression of DmTral_394-543DepositorInsertDmTral_394-543 (tral Fly)
UseTagsExpressionInsectMutationthree silent mutations A198C, A387G, A1437G and 4…PromoterAvailable sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral_394-652_D
Plasmid#146139PurposeInsect Expression of DmTral_394-652DepositorInsertDmTral_394-652 (tral Fly)
UseTagsExpressionInsectMutationthree silent mutations A198C, A387G, A1437G and 4…PromoterAvailable sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-R21EE23K_C
Plasmid#146078PurposeInsect Expression of DmTral-R21EE23KDepositorInsertDmTral-R21EE23K (tral Fly)
UseTagsExpressionInsectMutationthree silent mutations A198C, A387G, A1437G and 4…PromoterAvailable sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-R21ES13AI15A_C
Plasmid#146079PurposeInsect Expression of DmTral-R21ES13AI15ADepositorInsertDmTral-R21ES13AI15A (tral Fly)
UseTagsExpressionInsectMutationthree silent mutations A198C, A387G, A1437G and 4…PromoterAvailable sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-R42EF44A_C
Plasmid#146080PurposeInsect Expression of DmTral-R42EF44ADepositorInsertDmTral-R42EF44A (tral Fly)
UseTagsExpressionInsectMutationthree silent mutations A198C, A387G, A1437G and 4…PromoterAvailable sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-S13AI15A_C
Plasmid#146081PurposeInsect Expression of DmTral-S13AI15ADepositorInsertDmTral-S13AI15A (tral Fly)
UseTagsExpressionInsectMutationthree silent mutations A198C, A387G, A1437G and 4…PromoterAvailable sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR/D-Topo genomic A. thaliana IMPORTIN ALPHA 4
Plasmid#175815PurposepENTR plasmid with genomic sequence of Arabidopsis thaliana IMPORTIN ALPHA ISOFORM 4 (AT1G09270) without stop codon for C-terminal epitope tagsDepositorInsertIMPORTIN ALPHA ISOFORM 4 (IMPA-4 Mustard Weed)
UsePentr plasmid for gateway cloningTagsnoneExpressionMutationPromoternoneAvailable sinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR/D-Topo CDS A. thaliana IMPORTIN ALPHA 2
Plasmid#175816PurposepENTR plasmid with CDS of Arabidopsis thaliana IMPORTIN ALPHA ISOFORM 2 (AT4G16143.1) without stop codon for C-terminal epitope tagsDepositorInsertIMPORTIN ALPHA ISOFORM 2 (IMPA-2 Mustard Weed)
UsePentr plasmid for gateway cloningTagsnoneExpressionMutationnatural polymorphism P65S, annotated in Genbank f…PromoternoneAvailable sinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR/D-Topo CDS A. thaliana IMPORTIN ALPHA 9
Plasmid#175817PurposepENTR plasmid with CDS of Arabidopsis thaliana IMPORTIN ALPHA ISOFORM 9 (AT5G03070.1) without stop codon for C-terminal epitope tagsDepositorInsertIMPORTIN ALPHA ISOFORM 9 (IMPA-9 Mustard Weed)
UsePentr plasmid for gateway cloningTagsnoneExpressionMutationPromoternoneAvailable sinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral_394-543-V5His6_D
Plasmid#146134PurposeInsect Expression of DmTral_394-543DepositorInsertDmTral_394-543 (tral Fly)
UseTagsExpressionInsectMutationtwo silent mutations (nucleotides A198C, A387G) a…PromoterAvailable sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-LSm-R21EE23KR42EF44A-V5His6_C
Plasmid#146071PurposeInsect Expression of DmTral-LSmR21EE23KR42EF44ADepositorInsertDmTral-LSmR21EE23KR42EF44A (tral Fly)
UseTagsExpressionInsectMutationR21E, E23K, R42E, F44A. Additionally, one silent …PromoterAvailable sinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-R42EF44A_C
Plasmid#146061PurposeInsect Expression of DmTral-R42EF44ADepositorInsertDmTral-R42EF44A (tral Fly)
UseTagsExpressionInsectMutationR42E, F44A. Additionally, two silent mutations A1…PromoterAvailable sinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-LSm-R21EE23KS13AI15A-V5His6_C
Plasmid#146049PurposeInsect Expression of DmTral-LSmR21EE23KS13AI15ADepositorInsertDmTral-LSmR21EE23KS13AI15A (tral Fly)
UseTagsExpressionInsectMutationS13A, I15A, R21E, E23K, one silent mutation A198C…PromoterAvailable sinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
MIOX only
Plasmid#166681PurposeYeast integrative plasmid for expressing mouse myo-inositol oxygenase (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertMIOX (Miox Synthetic, Budding Yeast, Mouse)
UseSynthetic BiologyTagsExpressionYeastMutationPromoterGAL10Available sinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorInsertgRNA targeting AAVS1 intron 1 (PPP1R12C Human)
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Apc-g1)-PGKpuroBFP-W
Plasmid#105022PurposeLentiviral gRNA plasmid targeting mouse Apc , co-expression of TagBFPDepositorInsertApc (Apc Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Hgs-g1)-PGKpuroBFP-W
Plasmid#105032PurposeLentiviral gRNA plasmid targeting mouse Hgs , co-expression of TagBFPDepositorInsertgRNA targeting Hgs (Hgs Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
Empty Bridge Control Zfp462-Klf4SE
Plasmid#127666PurposeEncodes for 4 gRNAs expressed from their individual hU6 promoters. Two gRNAs target the Zfp462 promoter while the other two target the Klf4 stretch enhancer.DepositorInsertgRNAs 129, 135, 115, 117
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-624-5p
Plasmid#103681PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-624-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-624-5p target (MIR624 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-942-3p
Plasmid#103758PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-942-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-942-3p target (MIR942 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-942-5p
Plasmid#103759PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-942-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-942-5p target (MIR942 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-885-5p
Plasmid#103745PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-885-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-885-5p target (MIR885 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-744-3p
Plasmid#103726PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-744-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-744-3p target (MIR744 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-758-3p
Plasmid#103728PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-758-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-758-3p target (MIR758 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-758-5p
Plasmid#103729PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-758-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-758-5p target (MIR758 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-765
Plasmid#103730PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-765 target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-765 target (MIR765 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only