We narrowed to 7,060 results for: Ank
-
Plasmid#169222PurposeTargeting vector backbone to support a knock-in of mTurquoise2-Linker at the N-terminus of a target locusDepositorInsertDouble SapI flanked mTurquoise2
UseTargeting vector backboneTagsExpressionMutationPromoterAvailable sinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTub-alpha1-EB3-NeonGreen-T2A-iLifeact-mCherry
Plasmid#175261Purposelabelling of microtubule plus end and F-actin structuresDepositorInsertEB3-NeonGreen-T2A-iLifeact-mCherry (MAPRE3 Human)
UseTagsmCherry (on iLifeact) and mNeonGreen (on EB3)ExpressionMammalianMutationNone (wt)PromoterpTub-alpha1Available sinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR-AmCyan
Plasmid#138481PurposeFor cloning sgRNA flanked by two ribozyme elements, to subsequently cloned into PL-5LTR-GW-A vector.DepositorInsertAmCyan
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
TVBB C-term-mTurquoise2
Plasmid#169223PurposeTargeting vector backbone to support a knock-in of Linker-mTurquoise2 at the C-terminus of a target locusDepositorInsertDouble SapI flanked mTurquoise2
UseTargeting vector backboneTagsExpressionMutationPromoterAvailable sinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCol1a1-frt (FVB)
Plasmid#63575PurposeTargeting vector for the Col1a1 locus that contains a Neo resistance cassette flanked by FRT sites, followed by an ATG-less Hygromycine resistance gene. The homology arms match the sequence of FVB.DepositorInsertCol1A-frt-hygro-pA
UseMouse Targeting; Frt/flpeTagsExpressionBacterial and MammalianMutationPromoterNoneAvailable sinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pENTR-DMD-Donor
Plasmid#60605PurposeKnock-in donor vector to insert Exon 44 in front of Exon 45 of human DYSTROPHIN (DMD)gene, include EF1a-hygromycin resistance cassette flanked by loxP sequences.DepositorInsertHygromycin resistant gene
UseKnock-in donor vectorTagsExpressionMammalianMutationPromoterAvailable sinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCINeo-mCHMP5
Plasmid#11771DepositorInsertchromatin modifying protein 5 (Chmp5 Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 12, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Topo Vglut2 in situ probe
Plasmid#45639DepositorInsertVglut2 in situ probe (Slc17a6 Mouse)
UseIn situTagsExpressionMutationfragment contains nt 2477-2993 of slc17a6 (Vglut2…PromoterAvailable sinceJune 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1/mCherry-DMDEx23
Plasmid#211367PurposeExpresses a DMD exon 23 skipping reporter in mammalian cells (mCherry-DMDEx23)DepositorInsertmCherry-DMDEx23
UseTagseGFPExpressionMammalianMutationmCherry interrupted by mdx dystrophin exon 23 bet…PromoterCMVAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
TVBB N-term-mNeongreen
Plasmid#169226PurposeTargeting vector backbone to support a knock-in of mNeongreen-Linker at the N-terminus of a target locusDepositorInsertDouble SapI flanked mNeongreen
UseTargeting vector backboneTagsExpressionMutationPromoterAvailable sinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENT-L1-Kozak-Ensconsin-3XGFP-stop-L2
Plasmid#186361PurposeEntry clone with ORF encoding the MT-binding domain of Ensconsin fused to 3 copies of GFP in C-terminal, flanked by Gateway recombination sequences.DepositorInsertHuman Ensconsin (MAP7 Synthetic, Human)
UseExpression of a fluorescent microtubule markerTags3xEGFPExpressionMutationPromoterAvailable sinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENT-L1-Kozak-GAP43-ECFP-stop-L2
Plasmid#186356PurposeEntry clone with ORF encoding plasma membrane-targeted GAP43-eCFP flanked by Gateway recombination sequencesDepositorInsertGrowth-associated protein-43 (Gap43 Synthetic, Mouse)
UseExpression of a fluorescent membrane markerTagsECFPExpressionMutationPromoterAvailable sinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins6
Plasmid#195043PurposepFA6a derived selection cassette 5' flanked with tDEG1 transcription terminator, allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…ExpressionMutationPromoterAvailable sinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRSET-XS-VWF
Plasmid#64847PurposeExpresses aa1594–1670 of VWF A2 domain flanked by Venus and Cerulean and tagged with 7X His at C terminusDepositorInsertVenus_VWF A2 domain aa 1594-1670_Cerulean_TEV_7X His (VWF Synthetic, Human)
UseTags7X His, Cerulean, and VenusExpressionBacterialMutationPromoterT7Available sinceMay 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBactin-Nedd1-mNeonGreen
Plasmid#196864PurposeExpression of neural precursor cell expressed developmentally down-regulated 1 (Need1) fused to mNeonGreenDepositorInsertNedd1-mNeonGreen (Nedd1 Rat)
UseTagsExpressionMammalianMutationPromoterChicken bactin (plus Chicken bactin intron)Available sinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMTB2-NLS-BirA-2A-mCherry_Ras
Plasmid#80067PurposeBeta-actin2 promoter driving HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialMutationPromoterBeta-actin2Available sinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMTB2-cytoBirA-2A-mCherry_Ras
Plasmid#80066PurposeBeta-actin2 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialMutationPromoterBeta-actin2Available sinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H3C2
Plasmid#207783PurposeDonor template for moxGFP-2A-Puro insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a moxGFP-Puro Cassette (H3C2 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
natMX-ins7
Plasmid#195044PurposepFA6a derived selection cassette 5' flanked with tCYC1 transcription terminator, allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertNatR
UseYeast genomic targetingTagstCYC1 S. cerevisiae, pPGK1 C. glabrata, NatR, tPG…ExpressionMutationPromoterAvailable sinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-sTagRFP-TUBA1B
Plasmid#207768PurposeDonor template for Blast-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Blast-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMT-myl7-cytoBirA-2A-mCherry_Ras
Plasmid#80060PurposeMyl7 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialMutationPromoterMyl7 promoterAvailable sinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1 ObLiGaRe Donor vector/EPB58
Plasmid#90016PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to AAVS1 locusDepositorInsertMCS flanked by inverted ZFN binding sites (PPP1R12C Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau7-12WT
Plasmid#194166PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by the wild-type tau cDNA exons 7,9-12. Expresses the tau circRNA 12-->7 WT with 3X flag tag in exon 7.DepositorInsertMicrotubule-associated protein tau 7-12 WT
UseTags3X FlagExpressionMammalianMutationPromoterAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau10-12WT
Plasmid#194163PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by the wild-type tau cDNA exons 10-12. Expresses the tau circRNA 12-->10 WT with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 WT ZKSCAN1 intronic alu elements
UseTags3X flag tagExpressionMammalianMutationPromoterAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMT-zic2a-cytoBirA-2A-mCherry_Ras
Plasmid#80064PurposeZic2a promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialMutationPromoterZic2a enhancer driving c-fos promoterAvailable sinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMT-ubb-NLS-BirA-2a-mCherry
Plasmid#79886PurposeUbiquitin promoter driving HA-tagged biotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein; flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseTags3x HAExpressionBacterialMutationPromoterUbiquitinAvailable sinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMT-MCS-NLS-BirA-2A-mCherry_Ras
Plasmid#80059PurposeMCS for cloning promoter to drive HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialMutationPromoterAvailable sinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 PhiC31 attP:TMtb:P35S:attB (GB1494)
Plasmid#160577Purpose35S promoter sequence and the Mtb terminator flanked by two opposing PhiC31 site-specific recombination sites (attP and attB)DepositorInsertPhiC31 PB (attP:TMtb:P35S:attB)
UseSynthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
TVBB C-term-Dendra2
Plasmid#169216PurposeTargeting vector backbone to support a knock-in of Linker-Dendra2 at the C-terminus of a target locusDepositorInsertDouble SapI flanked Dendra2-P2A-Puro
UseTargeting vector backboneTagsExpressionMutationPromoterAvailable sinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
C-His-GvpC-Calpain
Plasmid#153295PurposeExpresses calpain-sensitive variant of Anabaena flos-aquae GvpC in E.coliDepositorInsertCalpain-sensitive Gas vesicle protein C (his-tagged)
UseTagsHis-tagExpressionBacterialMutation1) Contains an extra glycine after the methionine…PromoterT7Available sinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
STK32B gRNA (BRDN0001146403)
Plasmid#76373Purpose3rd generation lentiviral gRNA plasmid targeting human STK32BDepositorInsertSTK32B (STK32B Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK32B gRNA (BRDN0001145394)
Plasmid#76374Purpose3rd generation lentiviral gRNA plasmid targeting human STK32BDepositorInsertSTK32B (STK32B Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK32B gRNA (BRDN0001144884)
Plasmid#76375Purpose3rd generation lentiviral gRNA plasmid targeting human STK32BDepositorInsertSTK32B (STK32B Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVM-SFT-SP
Plasmid#234902PurposeThis all-in-one vector is used to overexpress the GhSFT gene via virus-mediated overexpression (VOX), and specifically silence the GhSP gene via virus-induced gene silencing (VIGS), simultaneously.DepositorInsertAdditional VA component flanked with VIGS fragment of GhSP gene and coding sequence of GhSFT
UseTagsExpressionPlantMutationPromoterAvailable sinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-AtmiR173aTS-B/c
Plasmid#227965PurposeExpression plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. For expressing syn-tasiRNAs in Arabidopsis thaliana.DepositorInsertsB/c
AtmiR173aTS
UseTagsExpressionPlantMutationPromoter35S and NoneAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-NbmiR482aTS-B/c
Plasmid#227967PurposeExpression plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. For expressing syn-tasiRNAs in Nicotiana benthamiana.DepositorInsertsB/c
NbmiR482aTS
UseTagsExpressionPlantMutationPromoter35S and NoneAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC177_CCR5(PGK-synEPOR)
Plasmid#232415PurposeAAV production plasmid for PGK(synEPOR) vector from Figs. 3-5 that mediates HDR at CCR5 locus using CCR5 gRNA. synEPOR is followed by BGH polyA. AAV genome is flanked by AAV2 ITRs.DepositorInsertTruncated Erythropoietin Receptor (EPOR Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceMarch 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
Aquamarine-LC3B G120A-TdLanYFP
Plasmid#228561PurposeEncodes an uncleavable version of the LC3B biosensor. Mutated LC3B is flanked by the Aquamarine/TdLanYFP donor/accpetor FRET pair and under the control of the CMV promoterDepositorInsertMAP1LC3B (MAP1LC3B Human)
UseTagsAquamarine and TdLanYFPExpressionMammalianMutationPromoterCMVAvailable sinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mScarlet-MAPRE1
Plasmid#227323PurposeDonor template for mScarlet insertion into the C-terminus of the MAPRE1 locus. For growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 (Addgene #207793)DepositorInsertMAPRE1 Homology Arms flanking a mScarlet Tag (MAPRE1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-EZR
Plasmid#227294PurposeDonor template for mStayGold insertion into the C-terminus of the EZR locus. For membrane visualization. To be co-transfected with sgRNA plasmid px330-EZR (Addgene #227293)DepositorInsertEZR Homology Arms flanking a mStayGold Tag (EZR Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-H3C2
Plasmid#227334PurposeDonor template for mStayGold insertion into the C-terminus of the H3C2 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 (Addgene #207780)DepositorInsertH3C2 Homology Arms flanking a mStayGold Tag (H3C2 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-miRFP670nano3-H3C2
Plasmid#227335PurposeDonor template for miRFP670nano3 insertion into the C-terminus of the H3C2 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 (Addgene #207780)DepositorInsertH3C2 Homology Arms flanking a miRFP670nano3 Tag (H3C2 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-MAPRE1
Plasmid#227324PurposeDonor template for mStayGold insertion into the C-terminus of the MAPRE1 locus. For growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 (Addgene #207793)DepositorInsertMAPRE1 Homology Arms flanking a mStayGold Tag (MAPRE1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-TUBA1B
Plasmid#227321PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the TUBA1B locus. For tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B (Addgene #207763)DepositorInsertTUBA1B Homology Arms flanking a Puro-2A-mStayGold Cassette (TUBA1B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-MAP4
Plasmid#227296PurposeDonor template for mStayGold insertion into the N-terminus of the MAP4 locus. For microtubule visualization. To be co-transfected with sgRNAplasmid px330-PITCh-MAP4 (Addgene #227295)DepositorInsertMAP4 Homology Arms flanking a mStayGold Tag (MAP4 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CEP192
Plasmid#227289PurposeDonor template for mStayGold insertion into the C-terminus of the CEP192 locus. For pericentriolar material visualization. To be co-transfected with sgRNA plasmid px330-PITCh-CEP192 (Addgene #227288)DepositorInsertCEP192 Homology Arms flanking a mStayGold Tag (CEP192 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-rox-nls-mCherry-V5-2xStop-rox (JDW 1167)
Plasmid#224524PurposeA Gateway compatible middle entry clone containing a Rox flanked 3xNLS-mCherry-V5-2xStop cassetteDepositorInsertrox-3xNLS-mCherry-V5-2xSTOP-rox
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-lox-3xNLS-mCherry-V5-SV40pA-3xstop-lox (JDW 1232)
Plasmid#224522PurposeA Gateway compatible middle entry clone containing loxP flanked 3xNLS-mCherry-V5-3xSTOP cassetteDepositorInsertlox-3xNLS-mCherry-V5-SV40pA-3xstop-lox
UseCre/LoxTagsExpressionMutationPromoterAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-V5-LMNB1
Plasmid#207779PurposeDonor template for Blast-2A-V5 insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-V5 Cassette (LMNB1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits