We narrowed to 27,684 results for: CHI
-
Plasmid#53019PurposeAmpR + PLlacO-1::RBS (st7) fimB::Asp terminator + ColE1DepositorInsertfimB
UseSynthetic BiologyTagsRBS(st7)ExpressionBacterialPromoterpLlac0-1Available SinceMay 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pACCS3-1
Plasmid#78559Purpose4.7 kb HindIII ETEC CS3 fimbrial operon from pCS100 cloned into pACYC184.DepositorInsertcs3 operon
ExpressionBacterialPromotertetAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMB1-spect-PthrC4-eGFP
Plasmid#107410PurposeThis plasmid contain promoter PthrC4, which is used for study about Short, Auto-inducible Promoters for Well-Controlled Protein Expression in Escherichia coli.DepositorInserteGFP
ExpressionBacterialPromoterPthrC4Available SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJB128 (MatP-mEos2)
Plasmid#72653PurposeInducible expression of MatP-mEos2 in bacteriaDepositorInsertMatP-mEos2
TagsmEos2ExpressionBacterialPromoterT5-lacAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-H1-sgRNA-hTZAP
Plasmid#87186PurposeguideRNA targeting exon1 of human TZAPDepositorAvailable SinceMarch 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLPC-Flag-TZAPZNF9-11
Plasmid#87184Purposeretroviral stable expression of truncation protein Flag-TZAPZNF9-11DepositorAvailable SinceMarch 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHL 1916
Plasmid#53023PurposeAmpR + PLtetO-1::RBS (st7) fimB::Asp terminator + ColE1DepositorInsertfimB
UseSynthetic BiologyTagsAsp terminator and RBS(st7)ExpressionBacterialPromoterpLtetO-1Available SinceMay 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
RCAS (A) Caronte (CT#382)
Plasmid#13862DepositorInsertCaronte (CER1 Chicken)
UseRetroviral; Avian expressionAvailable SinceFeb. 9, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBT234_(pCA-G-intron-tTA2)
Plasmid#36874DepositorInsertsGFP
tTA2
beta-globin intron
ExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer)Available SinceJuly 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
human pirh2-(138-189)
Plasmid#24881DepositorAvailable SinceAug. 5, 2010AvailabilityAcademic Institutions and Nonprofits only -
p305N-5
Plasmid#246288PurposeEvaluation of AtU6.1m2 promoter (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertAtU6.1m2 promoter
UseCRISPRExpressionPlantMutationA-to-C (-63 from TSS) and G-to-T (-57) within USEPromoterAtU6.1m2 promoterAvailable SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-13
Plasmid#246296PurposeEvaluation of CiU6.6 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertCiU6.6 promoter
UseCRISPRExpressionPlantPromoterCiU6.6 promoterAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-NLS-BioID2-HA
Plasmid#232025Purposemammalian expression (CMV promoter) of nuclear targeted BioID2-HADepositorInsertNLS
TagsNLSExpressionMammalianAvailable SinceNov. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-hisTdT
Plasmid#216674PurposeExpresses his-tagged N-terminus truncated TdT in E. coli hostsDepositorInsertterminal deoxynucleotidyl transferase
Tagshis-tagExpressionBacterialMutation1-138 truncationPromoterT7Available SinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N
Plasmid#246316PurposeA promoterless construct designed for cloning various Pol III promoters or serving as a control in evaluating Pol III promoters for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertPromoterless
UseCRISPRExpressionPlantPromoterPromoterlessAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-2
Plasmid#246285PurposeEvaluation of AtU3d promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertAtU3d promoter
UseCRISPRExpressionPlantPromoterAtU3d promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-7
Plasmid#246290PurposeEvaluation of AtU6.29 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertAtU6.29 promoter
UseCRISPRExpressionPlantPromoterAtU6.29 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-8
Plasmid#246291PurposeEvaluation of AtU6.29c14 promoter (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertAtU6.29c14 promoter
UseCRISPRExpressionPlantMutationT-to-C (-1 from TSS)PromoterAtU6.29c14 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-6
Plasmid#246289PurposeEvaluation of AtU6.1m3 promoter (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertAtU6.1m3 promoter
UseCRISPRExpressionPlantMutationG-to-T (-57 from TSS) within USEPromoterAtU6.1m3 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-15 (nonfunctional)
Plasmid#246298PurposeEvaluation of HbU6.2 promoter (nonfunctional) (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertHbU6.2 promoter (nonfunctional)
UseCRISPRExpressionPlantPromoterHbU6.2 promoter (nonfunctional)Available SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-28
Plasmid#246311PurposeEvaluation of PtU6.1c1 promoter (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertPtU6.1c1 promoter
UseCRISPRExpressionPlantMutationC-to-A (-42 from TSS), A-to-C (-41)PromoterPtU6.1c1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-22
Plasmid#246305PurposeEvaluation of MtU6.6-70 promoter (Pol III promoter) deletion (70 bp) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertMtU6.6-70 promoter
UseCRISPRExpressionPlantPromoterMtU6.6-70 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-12
Plasmid#246295PurposeEvaluation of CiU6.4 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertCiU6.4 promoter
UseCRISPRExpressionPlantPromoterCiU6.4 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-21
Plasmid#246304PurposeEvaluation of MtU6.6-104 promoter (Pol III promoter) deletion (104 bp) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertMtU6.6-104 promoter
UseCRISPRExpressionPlantPromoterMtU6.6-104 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-19
Plasmid#246302PurposeEvaluation of MdU6.1 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertMdU6.1 promoter
UseCRISPRExpressionPlantPromoterMdU6.1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-18
Plasmid#246301PurposeEvaluation of MdU3.1 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertMdU3.1 promoter
UseCRISPRExpressionPlantPromoterMdU3.1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-10
Plasmid#246293PurposeEvaluation of CiU6.1 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertCiU6.1 promoter
UseCRISPRExpressionPlantPromoterCiU6.1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-14
Plasmid#246297PurposeEvaluation of CiU6.6c16 promoter (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertCiU6.6c16 promoter
UseCRISPRExpressionPlantMutationT-to-C (-2 from TSS)PromoterCiU6.6c16 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-11
Plasmid#246294PurposeEvaluation of CiU6.3c8 promoter (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertCiU6.3c8 promoter
UseCRISPRExpressionPlantMutationA-to-C (-23 from TSS)PromoterCiU6.3c8 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-24
Plasmid#246307PurposeEvaluation of a synthetic Pol III promoter based on the MtU6.6 promoter for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertMtU6.6m4 promoter
UseCRISPRExpressionPlantPromoterMtU6.6m4 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-25
Plasmid#246308PurposeEvaluation of a synthetic Pol III promoter based on the MtU6.6 promoter for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertMtU6.6m5 promoter
UseCRISPRExpressionPlantPromoterMtU6.6m5 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-27
Plasmid#246310PurposeEvaluation of PtU6.1 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertPtU6.1 promoter
UseCRISPRExpressionPlantPromoterPtU6.1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-1
Plasmid#246284PurposeEvaluation of AtU3b promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertAtU3b promoter
UseCRISPRExpressionPlantPromoterAtU3b promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-32
Plasmid#246315PurposeEvaluation of VvU6.1 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertVvU6.1 promoter
UseCRISPRExpressionPlantPromoterVvU6.1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-23
Plasmid#246306PurposeEvaluation of a synthetic Pol III promoter based on the MtU6.6 promoter for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertMtU6.6m1 promoter
UseCRISPRExpressionPlantPromoterMtU6.6m1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-20
Plasmid#246303PurposeEvaluation of MtU6.6-189 promoter (Pol III promoter) deletion (189 bp) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertMtU6.6-189 promoter
UseCRISPRExpressionPlantPromoterMtU6.6-189 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-29
Plasmid#246312PurposeEvaluation of PtU6.2 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertPtU6.2 promoter
UseCRISPRExpressionPlantPromoterPtU6.2 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-16
Plasmid#246299PurposeEvaluation of HbU6.2m1 promoter (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertHbU6.2m1 promoter
UseCRISPRExpressionPlantMutationA-to-G (-56 from TSS), C-to-T (-29), G-to-A (-24)PromoterHbU6.2m1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-DEST47-SIRT2
Plasmid#242132PurposeExpression in mammalian cellsDepositorAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-miRFP703-eDHFR(69K6)-mSOS1-linkercat
Plasmid#214827PurposeEncoding mSOS1-linkercat fused to miRFP703DepositorInsertmiRFP703-eDHFR(69K6)-mSos1-linkercat
TagsmiRFP703ExpressionMammalianPromoterCAG promoterAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCSIIbleo-H2B-iRFP
Plasmid#214830PurposeEncoding nuclear-targeted iRFP713.DepositorInsertiRFP with nucleus-targeting sequence
UseLentiviralTagsH2B (human histone 2B)ExpressionMammalianPromoterEF-1αAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHOSPHO2-TEV-Twin-Strep
Plasmid#222016PurposeExpress human PHOSPHO2 protein (C-terminal Tobacco Etch Virus (TEV) protease cleavable Twin-Strep-fusion protein (ENLYFQGS-WSHPQFEK-(GGGS)2-GGSA-WSHPQFEK)) in mammalian cellDepositorInsertPHOSPHO2 (PHOSPHO2 Human)
TagsTEV cleavable site and Twin-Strep-tagExpressionMammalianMutationdeleted stop codon (TAA)Promoterchicken β-actin promoterAvailable SinceJan. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDSK519-cspB
Plasmid#207162PurposeExpresses codon-optimized cspB from Clavibacter michiganensis in a broad host range vectorDepositorInsertcspB
TagsHAExpressionBacterialPromoternptIIAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY380
Plasmid#182962PurposeAmp-resistant, low copy (p15A ori), E. coli 5'ptsI transcriptionally fused with GFP.DepositorInsertptsI
UseSynthetic BiologyTagsGFPAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY390
Plasmid#182963PurposeAmp-resistant, low copy (p15A ori), E. coli ptsI transcriptionally fused with GFP.DepositorInsertptsI
UseSynthetic BiologyTagsGFPAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGWT35S-VC155
Plasmid#194051PurposeTransient expression of VN155 (mVenus β-strands 8 to 11, amino acids 155−239) in plant cell (Cytosol)DepositorInsertVC155 (mVenus β-strands 8 to 11, amino acids 155−239)
ExpressionPlantPromoterCaMV 35S promoterAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWT35S-AtOEP7(1-50aa)-mVenus
Plasmid#194000PurposeTransient expression of AtOEP7-mVenus in plant cell (Chloroplast outer envelope membrane)DepositorInsertmVenus
TagsAtOEP7 1–50aaExpressionPlantPromoterCaMV 35S promoterAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWT35S-VN154
Plasmid#194050PurposeTransient expression of VN154 (mVenus β-strands 1 to 7, amino acids 1−154) in plant cell (Cytosol)DepositorInsertVN154 (mVenus β-strands 1 to 7, amino acids 1−154)
ExpressionPlantPromoterCaMV 35S promoterAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRnc-gGFP129
Plasmid#189537PurposeExpresses E. Coli RNase III under control of pBAD promoter and constitutively expresses gUTR-129-GFPDepositorInsertsRNase III
gUTR-129-GFP
ExpressionBacterialMutationN/APromoterJ23119 and pBADAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only