-
Plasmid#200499PurposeLentiviral vector expressing gRNA targeting human MRPS26DepositorInsertMRPS26(15) (MRPS26 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(AAVS1)-hU6gRNA5(BbsI)-PGKpuroBFP-W
Plasmid#200502PurposeLentiviral vector expressing gRNA targeting human AAVS1DepositorInsertAAVS1 (AAVS1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(MRPS26(12))-PGKpuro2ABFP-W
Plasmid#200498PurposeLentiviral vector expressing gRNA targeting human MRPS26DepositorInsertMRPS26(12) (MRPS26 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA2(46))-PGKpuro2ABFP-W
Plasmid#200465PurposeLentiviral vector expressing gRNA targeting human SMARCA2DepositorInsertSMARCA2(46) (SMARCA2 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(NDUFA1(12))-PGKpuro2ABFP-W
Plasmid#200495PurposeLentiviral vector expressing gRNA targeting human NDUFA1DepositorInsertNDUFA1(12) (NDUFA1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(MRPL21(16))-PGKpuro2ABFP-W
Plasmid#200497PurposeLentiviral vector expressing gRNA targeting human MRPL21DepositorInsertMRPL21(16) (MRPL21 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(NDUFA1(11))-PGKpuro2ABFP-W
Plasmid#200494PurposeLentiviral vector expressing gRNA targeting human NDUFA1DepositorInsertNDUFA1(11) (NDUFA1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(MRPL21(14))-PGKpuro2ABFP-W
Plasmid#200496PurposeLentiviral vector expressing gRNA targeting human MRPL21DepositorInsertMRPL21(14) (MRPL21 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-HAPPID1
Plasmid#204626PurposeExpresses the human anti-Phl p 7 IgD/λ antibody 102.1F10 (HAPPID1) in mammalian cells. HAPPID1 binds to the grass pollen allergen Phl p 7 with subnanomolar affinity.DepositorInsertsHAPPID1 heavy chain
HAPPID1 light chain
UseTagsExpressionMammalianMutationPromotermouse elongation factor 1 alpha and rat elongatio…Available sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET32a-hEPGN
Plasmid#199232PurposeBacterial production of soluble, active target proteins; Nterm thrombin and enterokinase cleavage sites.DepositorInsertEpithelial mitogen isoform 6 (EPGN Human)
UseTagsTrxA-6xHis-S-tagExpressionBacterialMutationPromoterT7Available sinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5-STABLE2-neo-RvCAHS3
Plasmid#192472PurposeStable expression of RvCAHS3 (fly codon optimized) in Drosophila cellsDepositorInsertCAHS3
UseTagsT2A-EGFP-T2A-neoRExpressionInsectMutationPromoterAc5 promoterAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSN554
Plasmid#177361PurposeExpresses human KIF1A(1-393) fused with leucine zipper, mScarlet and StrepII tagDepositorInsertKIF1A (KIF1A Human)
UseTagsLeucine zipper, StrepII tag, and mScarletExpressionBacterialMutationPromoterT7Available sinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmiRFP2-P2A-HO1-N1
Plasmid#178966PurposeExpresses miRFP2 and HO1 in mammalian cellsDepositorInsertmiRFP2-P2A-HO1
UseTagsnoExpressionMammalianMutationNOPromoterCMVAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD4-GCaMP6f
Plasmid#178727PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GCaMP6f in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGCaMP6f
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-GCaMP6f
Plasmid#178729PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of GCaMP6f in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGCaMP6f
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5-GCaMP6f
Plasmid#178731PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of GCaMP6f in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGCaMP6f
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS6-GCaMP6f
Plasmid#178732PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of GCaMP6f in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGCaMP6f
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-dTom
Plasmid#178716PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of dTom in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertdTom
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS2-V5-APEX2-NES
Plasmid#178702PurposeAAV vector for Cre-dependent transgene expression of V5-APEX2-NES in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertV5-APEX2-NES
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS3-V5-APEX2-NES
Plasmid#178703PurposeAAV vector for Flp-dependent transgene expression of V5-APEX2-NES in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertV5-APEX2-NES
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD4-GFP
Plasmid#178709PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGFP
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-GFP
Plasmid#178710PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of GFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGFP
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-GFP
Plasmid#178711PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of GFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGFP
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD2-V5-APEX2-NES
Plasmid#178696PurposeAAV vector for Cre-dependent transgene expression of V5-APEX-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertV5-APEX2-NES
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD3-V5-APEX2-NES
Plasmid#178697PurposeAAV vector for Flp-dependent transgene expression of V5-APEX2-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertV5-APEX2-NES
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDON223 Spike L241-L242-A243-
Plasmid#180070PurposeSars-CoV-2 protein mutationDepositorInsertSARS-CoV-2 Spike L241-L242-A243- (S SARS-CoV-2)
UseTagsMAC-tagExpressionMammalianMutationSpike L241-L242-A243-PromoterAvailable sinceJan. 13, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTD73
Plasmid#172897PurposeIntestinal promoter ges-1P::TIR1::F2A::TagBFP2::AID* with homology arms for insertion in ttTi4348 site on chromosome IDepositorInsertTIR-1 (TIR1 Mustard Weed)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTD81
Plasmid#172902PurposeHypodermal promoter col-10P::TIR1::F2A::TagBFP2::AID* with homology arms for insertion in ttTi5605 site on chromosome IIDepositorInsertTIR-1 (TIR1 Mustard Weed)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-N entry vector
Plasmid#111751PurposeIntermediate vector containing HTT gene, except for polyQ region. Used to clone various polyQ lengths into HTT sequence with N-term FLAG tag. Baculovirus transfer vector for insect and mammalian cellsDepositorTypeEmpty backboneUseBaculovirus expressionTagsFLAGExpressionMammalianMutationPromoterAvailable sinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET24a-VHH-1xTS
Plasmid#109418PurposeBacterial expression of a functionalized anti-GFP (VHH) nanobody fused to one tyrosine sulfation (TS) motif. VHH-1xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-GFP nanobody fused to a T7, TS, HA, BAP and His6 epitope
UseTagsBAP, HA, His6, T7, and Tyrosine sulfation (TS) se…ExpressionBacterialMutationPromoterT7Available sinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-SpdCas9-KRAB-tagBFP-PGK-Blasticidin
Plasmid#187953PurposeFKBP12 (F36V mutant) degron-tagged dCas9-KRAB domain fused to tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-SpdCas9-KRAB-tagBFP
UseCRISPR and Synthetic BiologyTagsGGSExpressionMammalianMutationPromoterAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-KRAB-SpdCas9-tagBFP-PGK-Blasticidin
Plasmid#187957PurposeFKBP12 (F36V mutant) degron-tagged KRAB-dCas9 fused with tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-KRAB-SpdCas9-tagBFP
UseCRISPR and Synthetic BiologyTagsGGSExpressionMammalianMutationPromoterAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-CasRx-tagBFP-PGK-Blasticidin
Plasmid#187952PurposeFKBP12 (F36V mutant) degron-tagged CasRx fused with tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-CasRx-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linker, HA-tag, and NLSExpressionMammalianMutationPromoterAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only