167,825 results
-
Plasmid#226857PurposeExpresses ABE8.20-NG base editor in mammalian cells with eGFP markerDepositorInsertABE8.20-NG
ExpressionMammalianPromoterCMVAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDD162 (Peft-3::Cas9 + Empty sgRNA)
Plasmid#47549PurposeCas9 + sgRNA plasmid that can be modified to cleave any Cas9 target site in the C. elegans genome.DepositorInsertsCas9
Empty sgRNA
UseCRISPRTagsHA and NLSExpressionWormMutationCodon optimized and with synthetic introns for C.…PromoterU6 and eef-1A.1 (eft-3)Available SinceSept. 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
TRE reporter backbone
Plasmid#158678PurposeThis plasmid serves as the backbone for the TRE reporters described in our paper. It's a promoterless-mStrawberry-pGK-BSD backbone to which we insert a pathway specific promoter before the mStrawberryDepositorTypeEmpty backboneUseLentiviralTagsmStrawberryExpressionMammalianAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMOS008: GCaMP6F calcium sensor (cytosolic)
Plasmid#163045PurposeGCaMP6F calcium sensor (cytosolic)DepositorInsertGCaMP6F
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.NES-jRGECO1a.WPRE.SV40
Plasmid#100854PurposeAAV expression of jRGECO1a, a red fluorescent calcium sensor protein, from the Synapsin promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, and AAV9InsertjRGECO1a
UseAAVExpressionMammalianPromoterSynapsinAvailable SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBBR1k-J23107-GFPuv
Plasmid#106389PurposepBBR1k-GFPuv with Anderson promoter J23107 expressing lacIDepositorInsertGFPuv
ExpressionBacterialPromotertrcAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEG BacMam N term His8 eGFP 3C
Plasmid#160684PurposeVector optimized for use in screening assays, as well as for efficient production of baculovirus and robust expression of the target proteinDepositorTypeEmpty backboneTagsHis8 eGFP 3CExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
CMV-mEGFP(A206K)-paCaMKII(K42M)
Plasmid#165440PurposeExpresses photoactivatable CaMKII(K42M: Kinase dead) in mammalian cells as a negative control.DepositorInsertmEGFP(A206K)-paCaMKII(K42M)
TagsmEGFP(A206K)ExpressionMammalianMutationK42M: Kinase dead mutationPromoterCMVAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
NPC1 His6 EGFP
Plasmid#53521DepositorInsertNPC1
TagsEGFP and His6ExpressionMammalianPromoterCMVAvailable SinceJuly 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-GRAB_5-HT1.0 (AAV9)
Viral Prep#140552-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hsyn-GRAB_5-HT1.0 (#140552). In addition to the viral particles, you will also receive purified pAAV-hsyn-GRAB_5-HT1.0 plasmid DNA. Synapsin-driven expression of GRAB_5-HT1.0 sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 neo
Plasmid#104996PurposeThis lentiviral construct delivers hSpCas9 and G418 resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET15b-RvLEAMshort
Plasmid#218122PurposeExpresses truncated RvLEAM protein under IPTG induction in bacterial host cells.DepositorInsertRvLEAMshort
Tags6xHISExpressionBacterialMutationTruncated form (58-181aa)PromoterT7Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCbs FlagOmomyc
Plasmid#113168PurposeExpression of FLAG tagged Omomyc in mammalian cellsDepositorAvailable SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCE048-SiT-Cas12a
Plasmid#128124PurposeExpress both AsCas12a and CRISPR arrays on single transcriptsDepositorInsertAsCas12a-Triplex
UseAAVExpressionMammalianAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B
Plasmid#103002Purposenon-standard AAV2 rep-AAV-PHP.B cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJR89
Plasmid#140096PurposesgRNA constant region and hU6 insert for programmed dual sgRNA cloning. The sgRNA constant region contains a capture sequence (cs1) in the stem loop for direct capture Perturb-seq.DepositorInsertsgRNA constant region CR3 with cs1 in stem loop and hU6 promoter
Available SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC1-mitoRexYFP
Plasmid#60246PurposeMitochondria-targeted genetically encoded fluorescent indicator for measuring NAD/NADH ratio.DepositorInsertmitoRexYFP
TagsMitochondrial targeting signalExpressionMammalianPromoterCMVAvailable SinceNov. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTW335c3
Plasmid#237322Purposeexpresses A. thaliana RbcL RbcS-6xHisDepositorInsertsTags6xHis and NoneExpressionBacterialAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-FLEX-jGCaMP8m-WPRE (AAV1)
Viral Prep#162381-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-CAG-FLEX-jGCaMP8m-WPRE (#162381). In addition to the viral particles, you will also receive purified pGP-AAV-CAG-FLEX-jGCaMP8m-WPRE plasmid DNA. CAG-driven, Cre-dependent expression of calcium sensor GCaMP8m (faster, more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
plenti.CamKII.(synapto).iATPSnFR2.A95A.A119L.miRFP670nano3
Plasmid#209730PurposeExpresses presynaptic low affinity ratiometric ATP sensorDepositorInsert(synapto).iATPSnFR2.A95A.A119L.miRFP670nano3
UseLentiviralExpressionMammalianPromoterCamKIIAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Tubulin-C-18
Plasmid#55148PurposeLocalization: Microtubules, Excitation: 587, Emission: 610DepositorAvailable SinceSept. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSF4 TetCMV 5'TOP intron Renilla-STOP 24xPP7 1xfirefly-siRNA xrRNA12 24xMS2 SV40 CTE polyA
Plasmid#104140PurposeExpresses TREAT-5'TOP reporter in mammalian cellsDepositorInsertRenilla luciferase
Tags24xMS2 stem loops in 3'UTR, 24xPP7 stem loop…ExpressionMammalianAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLCKO
Plasmid#73311PurposeLentiviral backbone for cloning and expressing U6 driven sgRNAs with BfuAI cloning sites and puromycin selection.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] (AAV1)
Viral Prep#84446-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] (#84446). In addition to the viral particles, you will also receive purified pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] plasmid DNA. CAG-driven, Cre-dependent expression of Jaws-KGC-tdTomato-ER2 for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomatoAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-MAP2K1
Plasmid#23406DepositorInsertMAP2K1 (MAP2K1 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo
Plasmid#139449PurposeLentiviral vector with gRNA scaffold and neomycin selectable markerDepositorInsertno sgRNA inserted; resistance gene: neoR
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-VprBP
Plasmid#133586PurposeExpresses human VprBP wildtype in mammalian cellsDepositorInsertVpr (HIV-1) binding protein (DCAF1 Human)
TagsHAExpressionMammalianMutationWildtype human VprBP (Dcaf1)Available SinceNov. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC407 - pAAV EF1a eGFP
Plasmid#60058PurposeAn AAV packaging vector that expresses enhanced green fluorescent protein under control of the EF1a promoter.DepositorInsertenhanced Green Fluorescent Protein
UseAAVExpressionMammalianPromoterEF1aAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMP11
Plasmid#215559PurposepKD46 with constitutively expressed Cas9 and an aTc gRNA targeting the ColE1 originDepositorInsertsCas9
gRNA targeting pBR322 origin of replication
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23105 and tetAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
Klc1-GFP
Plasmid#186617PurposeEncodes Kinesin Light Chain 1 fused to GFPDepositorAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX-TRE-dCas9-KRAB-MeCP2-BSD
Plasmid#140690PurposeInducible knockdown of gene expression in human cells for pooled scRNA-seq experimentsDepositorInsertCas9m4-KRAB-MeCP2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
EGFP-GRAM1b
Plasmid#211494PurposeExpression of EGFP-tagged GRAM domain of GRAMD1b (EGFP-GRAM1b) in mammalian cellsDepositorAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynapsin1-axon-GCaMP6s-P2A-mRuby3 (AAV9)
Viral Prep#112005-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSynapsin1-axon-GCaMP6s-P2A-mRuby3 (#112005). In addition to the viral particles, you will also receive purified pAAV-hSynapsin1-axon-GCaMP6s-P2A-mRuby3 plasmid DNA. Synapsin-driven, axon-targeted GCaMP6s calcium sensor and mRuby3 expression. The mRuby3 will be a separate protein (not a fusion protein). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmRuby3Available SinceApril 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/HF-CDC50A
Plasmid#209223PurposeMammalian expression of CDC50ADepositorAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP8s-WPRE
Plasmid#162377PurposeAAV-mediated expression of ultrafast protein calcium sensor under the Syn promoter, Cre-dependent expressionDepositorHas ServiceAAV Retrograde, AAV1, and AAV9InsertjGCaMP8s
UseAAV and Cre/LoxTags6xHisExpressionMammalianMutationS26M F286Y Q315HPromoterSynapsinAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag SRPK2
Plasmid#20525DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
PB-sgRNA(MS2)
Plasmid#102560PurposePiggybac transposon sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2. Contains BbsI sites for insertion of spacer sequences.DepositorTypeEmpty backboneUseCRISPR; Piggybac transposonExpressionMammalianPromoterU6Available SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMK411 (OsTIR1(F74G) mAID-EGFP-Nluc)
Plasmid#140659PurposeOsTIR1(F74G)-P2A-mAID-EGFP-NlucDepositorInsertOsTIR1(F74G) mAID-EGFP-Nluc TOL2
ExpressionMammalianAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA-hIFITM3
Plasmid#58397PurposeExpressed human IFITM3 with an N-terminal HA tag in mammalian cellsDepositorAvailable SinceSept. 4, 2014AvailabilityAcademic Institutions and Nonprofits only