We narrowed to 13,969 results for: Coli
-
Plasmid#182422PurposeBacterial expression of mNeongreen-Erythropoietin fusionDepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pMM627
Plasmid#112532PurposepZE2-PLhrtO-lux-hrtR-RBS2-chuA - Composite plasmid of pMM534 and pMM549, ColE1 origin, KanRDepositorInsertsHrtR
ChuA
luxCDABE
ExpressionBacterialPromoterJ23107, PL(HrtO), and ProDAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEM-Cas9HF1-indRecA56
Plasmid#102294PurposeModified from pEM-Cas9HF1 (Addgene ID: 89961) to co-express inducible recA56 to block recA-mediated double-strand break repair.DepositorInsertsCas9HF1
recA56
UseCRISPRExpressionBacterialMutationN497A/R661A/Q695A/Q926APromoterpTetAvailable SinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
meffRed chromoprotein
Plasmid#117836PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses meffRed chromoprotein in E. coliDepositorInsertpromoter, RBS, meffRed
UseSynthetic Biology; Escherichia coliMutationBioBrick sites removedAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-1_mNeongreen-Etanercept
Plasmid#182420PurposeBacterial expression of mNeongreen-Etanercept fusionDepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-1_hGH
Plasmid#182410PurposeBacterial expression of human growth hormoneDepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB1163
Plasmid#210032PurposeContains Cas3 gRNA cloning site, inducible Cas11-P2A-Cas6-T2A-Cas3, rtTA-T2A-blastDepositorInsertsCas11-P2A-Cas6-T2A-Cas3
rtta-T2A-blast
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterEF-1α and TRE3GAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCD565
Plasmid#153027PurposedxCas9(3.7), MCP-SoxS(R93A/S101A), J306 scRNADepositorInsertdxCas9(3.7), MCP-SoxS(R93A/S101A), J306 scRNA
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV iGluu
Plasmid#105832PurposeFast indicator for extracellular glutamate imagingDepositorInsertiGluSnFR S72T variant
TagsMyc and PDGFRExpressionMammalianMutationChanged Ser 72 to ThrPromoterCMVAvailable SinceJune 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKD072
Plasmid#136472PurposeSSB-C-term-GFP fusion expression plasmidDepositorInsertSSB-C-term-GFP (ssb E. coli)
Tagssuperfolder GFPExpressionBacterialMutationsuperfolder GFP attached to C-terminus at Phe 178PromoterT7 promoterAvailable SinceApril 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCCM
Plasmid#162708PurposeSecond CCM operon cloned from H. neapolitanus; pFA expressing the remaining 11 genes in the H. neapolitanus CCM clusterDepositorInsertSecond CCM operon cloned from H. neapolitanus
ExpressionBacterialPromoterPLtet0-1 promoterAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pH6-TEV-spTorA-GFP(C)
Plasmid#169041PurposeGFP preceeded by the signal peptide of TorA (spTorA) with an N-terminal 6xHis tag and TEV cleavage site in pBAD24.DepositorInsertH6-spTorA-GFP
Tags6xHis, TEV cleavage site, and spTorA (signal pept…ExpressionBacterialMutationThe mut3 GFP variant with 5 additional mutations …PromoteraraBADAvailable SinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNAS1B split mCherry N-ME(pS)VD/TRAP(RK)-C
Plasmid#61966PurposePositive control duet plasmid for SepOTS-dependent split mCherry assembly assay (i.e., N-mCherry is fused to the peptide ME(pS)VD (pS = phosphoserine); C-mCherry is fused to TRAP(RK))DepositorInsertsN-mCherry-ME(pS)VD
TRAP(RK)-C-mCherry
ExpressionBacterialPromoterPBAD and PLtetOAvailable SinceFeb. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSCL.177
Plasmid#184998PurposeExpress -Eco1 EMX1 editing ncRNA and gRNADepositorInsertEco1: EMX1 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationEMX1 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
LacI-11/109-pHG165c
Plasmid#90059PurposeDimeric LacI (truncated last 11 amino acids) polymorphism with T at position 109DepositorInsertLacI-11/109
ExpressionBacterialMutation109PromoterIqAvailable SinceJune 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNH-TrxT-G-S18
Plasmid#127827PurposeProduction of recombinant human ribosomal protein S18DepositorAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPPC011
Plasmid#171143PurposeExpression of Sp.pCas9-dCas9 and BBa_J23107-MCP-SoxS(R93A/S101A) on pRK2-KmR plasmidDepositorInsertSp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsPromoterSp.pCas9, BBa_J23107Available SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSCL.175
Plasmid#184996PurposeExpress -Eco1 HEK3 editing ncRNA and gRNADepositorInsertEco1: HEK3 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationHEK3 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.180
Plasmid#185001PurposeExpress -Eco1 AAVS1 editing ncRNA and gRNADepositorInsertEco1: AAVS1 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationAAVS1 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pAhpC-RBS- LacZ
Plasmid#190060PurposeLacZ containing colorimetric reporter plasmid expressing it under the control of the OxyR/H2O2 inducible pAhpC promoterDepositorInsertlacZ
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRCPam
Plasmid#195861PurposeEncodes chromogenic protein (CP) with nonsense mutation resulting in amber stop codon at amino acid 62. CP inducible with rhamnose in amber suppressor strains.DepositorInsertAmber Chromogenic Protein on pRCPam plasmid
ExpressionBacterialMutationGln62XAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAd5-Blue
Plasmid#174431PurposepAd5-Blue provides a platform for the rapid construction of recombinant and replication defective Adenovirus. This vector contains unique restriction enzyme sites to allow cloning of a gene.DepositorInsertβ-galactosidase α gene fragment
UseAdenoviralExpressionMammalianPromoterCMVAvailable SinceMay 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-1_VNp6-StefinA
Plasmid#182404PurposeBacterial expression of Vesicle Nucleating peptide6-stefinA fusionDepositorInsertVNp6-stefin (CSTA Human)
TagsVesicle Nucleating peptide 6 (VNp6)ExpressionBacterialPromoterT7Available SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
MBP-MEK1 S222TAG
Plasmid#68302PurposeN-terminal MBP tagged human MEK1 gene S222TAG for bacterial expressionDepositorAvailable SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
R26TV LSL-TRL
Plasmid#68476PurposeRosa26 targeting vector expressing Cre-dependent tTR-KRAB-rtTA3-Luc cassetteDepositorInserttTR-KRAB-2A-rtTA3-2A-Luciferase
UseCre/Lox, Luciferase, and Mouse TargetingExpressionMammalianPromoterCAGAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBEST-p70a-UTR1-NTerm 6xHis-zmADH-T500
Plasmid#92228PurposeExpression of zmADH using the p70a promoter and UTR1DepositorInsertNTerm 6xHis Tagged zmADH
UseSynthetic Biology; Cell free protein synthesis (c…Tags6xHisExpressionBacterialPromoterp70aAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV iGluf
Plasmid#105833PurposeFast indicator for extracellular glutamate imagingDepositorInsertiGluSnFR E25D variant
TagsMyc and PDGFRExpressionMammalianMutationChanged Glu 25 to AspPromoterCMVAvailable SinceJune 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-tagBFP-TetR
Plasmid#103797PurposeBLInCR 'Localizer' construct that marks tetO arrays and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorExpressionMammalianMutationTetR: A4G (M2V)PromoterCMVAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-1_VNp-StefinA
Plasmid#182403PurposeBacterial expression of Vesicle Nucleating peptide-stefinA fusionDepositorInsertVNp-stefin (CSTA Human)
TagsVesicle Nucleating peptide (VNp)ExpressionBacterialPromoterT7Available SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only