We narrowed to 1,708 results for: CAG promoter
-
Plasmid#199645PurposeExpresses Cas9 and sgRNA control guide targeting intergenic regionDepositorInsertN/A
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SwitchON-sgCh2-2
Plasmid#199637PurposeTamoxifen-inducible expression of sgRNA control targeting intergenic regionDepositorInsertN/A
UseLentiviralAvailable SinceJune 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shLacZ
Plasmid#223222Purposemir30 based shRNA strategy, control shRNADepositorInsertshLacZ
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYap1-5
Plasmid#193671PurposeTet inducible knockdown of Yap1DepositorInsertYap1 (Yap1 Mouse)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shRBFOX1-3260
Plasmid#115457PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYAP1-6
Plasmid#193667PurposeTet inducible knockdown of YAP1DepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
1197R_gZBF-ER
Plasmid#241825PurposegRNA expressing plasmid with broken SEPARATORDepositorInsertActin5C promoter
UseCRISPRExpressionInsectAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Std_BFP-to-EGFP_Dual_epegRNA_tevopreQ1
Plasmid#187459PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 pegRNA and EBFP_To_EGFP epegRNA (tevopreq1) from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + EBFP to EGFP epegRNA (tevopreq1) (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1sgRNA1
Plasmid#160945PurposeGuide RNA 1 to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
-161+80pCalb2/dmutNRF-1(-41;-35)-like
Plasmid#66741Purposeluciferase reporter for Calb2 promoter (-161to +80, mutant)DepositorInsertCalb2 promoter (-161bp+80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationCGCAGGCGC (-41;-35) to ATTAGGATTPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-PrPro
Plasmid#227454Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL2RN gRNA_multi1-3-MS2-Puro
Plasmid#192684PurposeLentiviral expression of multi gRNAs targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNAs #1,2,3 (IL1RN Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-iRFP670-P2A-puro
Plasmid#208399Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, iRFP670 fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-mNeonGreen-P2A-puro
Plasmid#208400Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, mNeonGreen fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsmNeonGreenExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v2)-PGK-Puro-BFP
Plasmid#117141PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v2 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAC1802_pmax-RBFOX1N-dCasRx-C
Plasmid#118635PurposeTransient transfection; Expresses RBFOX1N-dCasRx-C; CAGGS promoterDepositorInsertRBFOX1N-dCasRx-C
UseCRISPRExpressionMammalianPromoterCAGGSAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgAAVS1
Plasmid#184403PurposepX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGATDepositorInsertAAVS1-specific sgRNA
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
p3E-U6a-U6c-opa1 guide
Plasmid#121995PurposeAn entry vector with U6a and U6c promoter driving opa1 guide RNAs expressionDepositorInsertopa1 gRNA
UseCRISPRAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSC29
Plasmid#104803PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr4g094545 (Hen1). Also expresses Cas9 from Gmubi promoter.DepositorInsertMedtr4g094545
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
(pRZ60) AAV: U6-gRNA(cs1)-EF1a-eGFP
Plasmid#254582PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and capture sequence in scaffold and eGFP from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ318) AAV: U6-gRNA(FLEX)-EF1a-mScarlet
Plasmid#254587PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and 10x FLEX preferred scaffold and mScarlet from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ320) AAV: U6-gRNA(FLEX)-EF1a-ZsGreen
Plasmid#254588PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and 10x FLEX preferred scaffold and ZsGreen from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ76) AAV: U6-gRNA(cs1)-EF1a-mCherry
Plasmid#254583PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and capture sequence in scaffold and mCherry from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPN283
Plasmid#91666PurposeExpress sgRNA targeting human SDCCAG8DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSPneogRNA241510+MT
Plasmid#84292PurposeExpress LdPBK_241510.1 and LdMT targeting gRNAs simutaneouslyDepositorInsertLdBPK_241510.1 targeting gRNA and LdMT targeting gRNA
UseCRISPR; Leishmania donovaniPromoterL. donovani ribosome RNA promoterAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hASCL1 gRNA_1-MS2-Puro
Plasmid#192670PurposeLentiviral expression of sgRNA targeting hASCL1 promoter to activate human ASCL1 transcriptionDepositorInsertHuman ASCL1 activating gRNA #1 (ASCL1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
1197TCC_gZBF-HG
Plasmid#241826PurposepgSIT 2.0 gRNA expressing plasmid with working HR5Ie1-EGFP SEPARATOR cassetteDepositorInsertActin5C promoter
UseCRISPRExpressionInsectAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-PrPro
Plasmid#227453Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shYAP1-1
Plasmid#193692PurposeConstitutive lentiviral expression of YAP1 shRNADepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHes1-DsRed
Plasmid#13767DepositorInsertHes1 promoter
TagsDsRed2ExpressionMammalianAvailable SinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
pNrl-DsRed
Plasmid#13764DepositorInsertNrl promoter
TagsDsRed2ExpressionMammalianAvailable SinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR1
Plasmid#167000PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCELF4-4404
Plasmid#115465PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shMBNL1-3964
Plasmid#115459PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shCALM2-1
Plasmid#193699PurposeConstitutive lentiviral expression of CALM2 shRNADepositorInsertCALM2 (CALM2 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-RNF2_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172669PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human RNF2 gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertRNF2 pegRNA and RNF2_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
(pRZ75) AAV: U6-gRNA(cs1)-EF1a-Cre-P2A-mCherry
Plasmid#254581PurposeAAV backbone expressing Cre recombinase and mCherry from the EF1a promoter and one U6-driven sgRNA with SapI spacer and capture sequence in scaffoldDepositorInsertCre
UseAAVAvailable SinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1 double gRNAs
Plasmid#162791PurposeMultiplex Guide RNAs to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-Nono-sh5
Plasmid#127651PurposeKnock-down of human NONODepositorInsertNONO shRNA (NONO Human)
UseLentiviralAvailable SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-Crimson-P2A-puro
Plasmid#208398Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, E2-Crimson fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsE2-CrimsonExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2911
Plasmid#161764PurposeMODULE C plasmid compatible with the Voytas Plant Genome Engineering Tool kit with an Agrobacterium promoter rolD expressing the TREX2 exonuclease.DepositorInsertrolD:TREX2
ExpressionBacterialPromoterrolDAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-Fgf5Pro
Plasmid#227479Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-tdTomato
Plasmid#159275PurposeHuman AAVS1 targeting vector for knockin of a CAGGS promoter-driven tdTomato cassette (cloned between AgeI and PacI). Targeted cells will be puromycin resistant.DepositorInserttdTomato
UseAAV; S1 knockin donor vectorExpressionMammalianPromoterCAGGSAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN155
Plasmid#91684PurposeExpress sgRNA targeting human ZNF536DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
shERK2b-mlpx-puro
Plasmid#65230Purposeencodes a shRNA against ERK2DepositorAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
shERK2b-mlpx-neo
Plasmid#65231Purposeencodes a shRNA against ERK2DepositorAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only