We narrowed to 1,648 results for: CAG promoter
-
Plasmid#72621PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRho-Cre
Plasmid#13779DepositorInsertRhodopsin promoter-Cre
UseCre/LoxTagsMycExpressionMammalianAvailable SinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL3-2
Plasmid#109010PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgSLC25A39-2
Plasmid#251688PurposegRNA to knock out SLC25A39 in mammalian cellsDepositorInsertSLC25A39 solute carrier family 25 member 39 (SLC25A39 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
-
pCXN2-HA-AT1R-YFP
Plasmid#101659PurposeExpresses AT1R with HA tag and YFP in mammalian cells.DepositorInsertAngiotensin II type 1 receptor (AGTR1 Human)
TagsHA and YFP (Venus)ExpressionMammalianPromoterCAG promoterAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Blasticidin XLone-eGFP
Plasmid#159754PurposeAAVS1 donor plasmid for targeted inducible eGFP expression in human cellsDepositorInsertall-in-one tet-on system
UseCRISPR and TALEN; Donor plasmid for targeted knoc…ExpressionMammalianPromoterTRE3GS inducible promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCXN2-FLAG-AT2R-CFP
Plasmid#101660PurposeExpresses AT2R with FLAG tag and CFP in mammalian cells.DepositorInsertAngiotensin II type 2 receptor (AGTR2 Human)
TagsECFP and FLAGExpressionMammalianPromoterCAG promoterAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBT270_(pCA-G-intron(Neo)-tTA2-iiTRE-tdT3Mycii)
Plasmid#36881DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Hb9-CD14
Plasmid#204344PurposeKnock-in vector to insert a motor neuron-specific MACS-sortable genetic reporter into the AAVS1 locus in human pluripotent stem cells. Allows isolation of human iPSC-derived motor neurons.DepositorAvailable SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
PBGFAP-eGFP
Plasmid#40975DepositorInsertMouse GFAP promoter fragment
ExpressionMammalianAvailable SinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSC44
Plasmid#104818PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-1). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B-Pho2-1/2-2-tRNA
Plasmid#161761PurposeMODULE B tRNA vector with 6x gRNAs targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pMOD_B2303 - #91068)DepositorInsertgRNAs
ExpressionBacterialPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B-Pho2-1/2-2-Csy4
Plasmid#161760PurposeMODULE B Csy4 vector with 6x gRNAs targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pMOD_B2103 - #91061)DepositorInsertgRNAs
ExpressionBacterialPromoterCmYLCV PromoterAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSC45
Plasmid#104819PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-2). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC50
Plasmid#104824PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.08g081600, Glyma.05g126600 (Hen1ab). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.08g081600, Glyma.05g126600
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
TDP-43 mRuby K84ONBK
Plasmid#216226PurposeTDP-43 with a C-terminal mRuby tag and Lysine 84 in the NLS mutated to a TAG stop codon for amber codon suppression.DepositorInsertTransactive response DNA binding protein of 43 kDa (TARDBP Human)
ExpressionMammalianMutationLysine 84 mutated to a TAG stop codonPromoterCMV PromoterAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPN273
Plasmid#91644PurposeExpress sgRNA targeting human MMP16DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
SBC015866
Plasmid#226280PurposeExpresses BsSfp, MsCAD, and SrCAR from trc promoter. Biosynthesis of (hydroxy)cinnamyl alcohols from (hydroxy)cinnamic acids.DepositorInserts4'-phosphopantetheinyl transferase Sfp
Cinnamyl alcohol dehydrogenase
Carboxylic acid reductase
ExpressionBacterialAvailable SinceNov. 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLG1-puro-sgATL2-1
Plasmid#109008PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL1RN gRNA_1-MS2-Puro
Plasmid#192677PurposeLentiviral expression of sgRNA targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNA #1 (IL1RN Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCBASceI
Plasmid#26477PurposeI-SceI endonuclease expression vector with mammalian promoter to introduce a DSB at a genomic I-SceI siteDepositorInsertpCBASceI
TagsHAExpressionMammalianAvailable SinceOct. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV-gfaABC1D-mCherry-CAAX
Plasmid#218189PurposeTo over express mCherry-CAAX under gfaABC1D promoter in astrocytesDepositorInsertmCherry-CAAX
UseAAVExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pgfaABC1D-mCherry-CAAX
Plasmid#196488PurposeTo over express mCherry-CAAX under gfaABC1D promoter in astrocytesDepositorInsertmCherry-CAAX
UseAAVExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pISV-CRISPR/Cas9PGmUbi
Plasmid#209189PurposeExpression of Cas9 in the model legume Medicago truncatula, Gmubi promoter (PGmubi), DsRed and Basta selectionDepositorInsertsCas9
DsRed(deltaB)
TagsNLSExpressionPlantMutationmissing BsaI site and plant-codon optimized with …PromoterCaMV 35S and GmUbi from Glycine max (L.) Merr. cv…Available SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTALE-STAR-T_RFP entry
Plasmid#87526PurposeDestination vector for domain insertionDepositorTypeEmpty backboneUseSynthetic Biology and TALEN; Tale empty functiona…Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTALE-STAR-A_RFP entry
Plasmid#87527PurposeDestination vector for domain insertionDepositorTypeEmpty backboneUseSynthetic Biology and TALEN; Tale empty functiona…Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTALE-STAR-C_RFP entry
Plasmid#87528PurposeDestination vector for domain insertionDepositorTypeEmpty backboneUseSynthetic Biology and TALEN; Tale empty functiona…Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTALE-STAR-G_RFP entry
Plasmid#87529PurposeDestination vector for domain insertionDepositorTypeEmpty backboneUseSynthetic Biology and TALEN; Tale empty functiona…Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-1
Plasmid#223223Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgLIAS-1
Plasmid#251681PurposegRNA to knock out LIAS in mammalian cellsDepositorInsertLIAS lipoic acid synthetase (LIAS Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgETS1-1
Plasmid#251685PurposegRNA to knock out ETS1 in mammalian cellsDepositorInsertETS1 ETS proto-oncogene 1, transcription factor (ETS1 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
B270 + SMARCAL1 sgSTOP
Plasmid#100717PurposeB270 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) in combination with ATP1A1 sgSTOPDepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI) and ATP1A1 (SMARCAL1 Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-Fgf5Pro
Plasmid#227480Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-Fgf5Pro
Plasmid#227481Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-PrPro
Plasmid#227455Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-PrPro
Plasmid#227456Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-Csy4
Plasmid#161763PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x Csy4-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
ExpressionPlantPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-tRNA
Plasmid#161762PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x tRNA-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
ExpressionPlantPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVUTHshGATA1-tTR-KRAB
Plasmid#11650PurposeTet-regulated (Tet-on) lentiviral vector for shGATA1 (hUbiquitin promoter) - 3rd generationDepositorInserthUbiquitin C, GFP, tTR-KRAB, shRNA against GATA1, Tet-on (GATA1 Human)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSC4
Plasmid#91182PurposeT-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN262
Plasmid#91607PurposeExpress sgRNA targeting human EPHX2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN060
Plasmid#91593PurposeExpress sgRNA targeting human CYP26B1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN287
Plasmid#91670PurposeExpress sgRNA targeting human SLC45A1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSC3
Plasmid#91181PurposeT-DNA vector for targeted deletion of 58kb region in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + SMARCAL1 sgSTOP
Plasmid#100715PurposeB52 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
INS-CRa-Lsg-MS2
Plasmid#247478PurposesgRNA for INS activation cloned into LsgRNA-MS2 backboneDepositorAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
B52 + PARP4 sgSTOP
Plasmid#100711PurposeB52 plasmid expressing PARP4 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting PARP4 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only