173,387 results
-
Plasmid#46262PurposeBacterial targetingDepositorTypeEmpty backboneUseBacterial targetingAvailable SinceAug. 14, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pCAG-mEGFP-CaMKIIa (T305D/T306D)
Plasmid#127611PurposeFluorescent reporter for mutant Ca2+/calmodulin-dependent protein kinase II alpha (T305D/T306D)DepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Rat)
TagsmEGFPExpressionMammalianMutationchanged Threonine 305/306 to AlaninePromoterpCAGAvailable SinceJan. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX6p1-GST-Rnf31
Plasmid#63134PurposeExpression of human RNF31/HOIP codon optimized for E. coli and insect cellsDepositorInsertRnf31 (RNF31 Human, Synthetic)
TagsGSTExpressionBacterialMutationSynthetic based on human protein sequencePromotertacAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
Antibody#180092-rAbPurposeAnti-HCN1 (Rat) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunohistochemistry and Western BlotReactivityHuman, Mouse, and RatSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceMarch 30, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pHR_SFFV_tTA_IRES_tagBFP
Plasmid#231953PurposeLentiviral vector for constitutive expression of the tetracycline transactivator tTA and of the blue fluorescent protein tagBFP, separated by an internal ribosome entry site (SFFV promoter)DepositorInserttTA_IRES_tagBFP
UseLentiviralAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-Nme2ABE8e
Plasmid#189928PurposePlasmid encoding Nme2ABE8e driven by the CMV promoter for plasmid transfection.DepositorInsertNme2ABE8e
TagsNLSExpressionMammalianMutationNme2Cas9 D16APromoterCMVAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_Cas9–superNLS
Plasmid#232430PurposeExpression plasmid for the SpCas9 nuclease with superNLSDepositorInsertCas9–superNLS
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3-RANGAP.C-linker.miniIAA7.3xFlag.P2A.BSD
Plasmid#216248PurposeHDR template to tag endogenous human RANGAP1 C-terminus with miniIAA7.3xFlag.P2A.BSDDepositorInsertHDR template for human RANGAP1 (RANGAP1 Human)
UseCRISPR and TALEN; Hdr templateTagsminiIAA7.3xFlag.P2A.BSDExpressionMammalianAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV-NLS-ISYmu1-NLS-3xHA-bGHpA;U6-BsaI-reRNA
Plasmid#205317PurposeAll-in-one AAV vector expressing ISYmu1 TnpB and its reRNADepositorInserthumanized ISYmu1 TnpB
UseAAVTags3 x HAExpressionMammalianAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
JS200 strain
Bacterial Strain#11794DepositorBacterial ResistanceNoneAvailable SinceJune 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-flex-iGluSnFR4f-NGR-WPRE
Plasmid#234442PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorHas ServiceAAV1InsertiGluSnFR4f-NGR
UseAAV and Cre/LoxTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-OTUD4 (OTU, aa 22-196)
Plasmid#61413PurposeExpresses human OTUD4 (OTU domain) in E. coli.DepositorInsertOTUD4 (OTU domain-containing protein 4) (OTUD4 Human)
TagsHis6-GST-3CExpressionBacterialMutationDeleted aa 1-21 and aa 197-1114.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiPVe3_GCaMP6f (AAV PHP.eB)
Viral Prep#213943-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV_BiPVe3_GCaMP6f (#213943). In addition to the viral particles, you will also receive purified pAAV_BiPVe3_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the PV+ basket cell-targeting enhancer E3. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1651-sgTelomere(F+E)
Plasmid#51024PurposeLentiviral vector that contains an optimized S. pyogenes sgRNA targeting human telomeresDepositorInsertOptimized sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6 promoterAvailable SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-anti-GFP(LaG17) PAGER(TF)
Plasmid#229997PurposeExpresses anti-GFP PAGER(TF) (high reversibility) in mammalian cells; used with NanoLuc-Arrestin-TEVp (Addgene #125228) and UAS-Firefly Luciferase reporter (Addgene #104840)DepositorInsertIL2SP-Aro6-LaG17-TEVcs-ALFA-KORD(RAA)-LOV-TEVcs-Gal4
UseAAVExpressionMammalianMutationV360A/R361A on KORDPromoterCMVAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSDMA58
Plasmid#67942PurposeComplementation in Cryptococcus neoformans. Targets DNA constructs to a Safe Haven Site, a small gene-free region. Contains HYG resistance marker.DepositorTypeEmpty backboneUseCryptococcal complementation vectorPromoterACT1 for Cryptococcal markerAvailable SinceOct. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C3-PLK4-3xFLAG
Plasmid#69837PurposeThis plasmid encodes PLK4 isoform 1 with an N-terminal EGFP tag and C-terminal 3xFLAG tagDepositorAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC1-A_sgBC1-C
Plasmid#154196PurposeLentiviral expression plasmid encoding two sgRNAs for targeting of the CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC1-A, sgRNA-BC1-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE (AAV PHP.eB)
Viral Prep#104495-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE (#104495). In addition to the viral particles, you will also receive purified pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE plasmid DNA. CAG-driven, Cre-dependent GCaMP7s calcium sensor. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF mito-cGFP (matrix)
Plasmid#188904PurposeExpresses mitochondrial GFPDepositorInsertmitochondrial GFP
TagsMitochondrial leader sequence: MSVLTPLLLRGLTGSARR…ExpressionMammalianAvailable SinceOct. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4TO-24xGCN4_v4-sfGFP
Plasmid#61058PurposeA direct fusion of sfGFP to the 24xGCN4_v4 peptide arrayDepositorInsert24xGCN4_v4 peptide array and sfGFP
ExpressionMammalianAvailable SinceNov. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
hCMV-IE1:RedF
Plasmid#118064PurposeTranscriptional unit for constitutive expression of RedF in mammalian cellsDepositorInsertCMV:RedF:bGHF
UseLuciferase and Synthetic Biology; Assembly of gb2…ExpressionMammalianPromoterCMVAvailable SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
SIV_Gag_Pol
Plasmid#236243Purpose3rd generation SIV-based lentiviral packaging plasmid; Contains SIV Gag and PolDepositorInsertSIV Gag and Pol
UseLentiviralAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSC5GGv2
Plasmid#188604PurposepSC5 Golden-Gate Cloning Plasmid (BsaI - Site 2)DepositorTypeEmpty backboneUseSynthetic Biology; Diatom expressionExpressionBacterial and YeastAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
FNLCR CRISPRa Cell Surface
Pooled Library#207471PurposeCRISPR-based activation library with guide RNAs targeting all cell surface proteins.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
plenti-CAG-IKZF1-V1-FLAG-IRES-GFP
Plasmid#107387PurposeLentiviral expression of IKZF1-V1-FLAGDepositorAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
CaTCH_empty-backbone
Plasmid#157746PurposeLentiviral CaTCH barcoding plasmid harboring an emtpy cloning site to insert a CaTCH barcoding library or individual barcode sequencesDepositorTypeEmpty backboneUseLentiviral; Catch barcode cloningExpressionMammalianAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
p5xATF6-GL3
Plasmid#11976PurposeReporter gene with five ATF6 sites that is highly sensitive to ER stressDepositorInsert5xATF6 binding site
TagsLuc and c-fos promoterExpressionMammalianAvailable SinceAug. 10, 2007AvailabilityAcademic Institutions and Nonprofits only -
Lamp1-mCherry-RUSH
Plasmid#202799PurposeRUSH cargo: Str-KDEL_IRES_SBP-mCherry-Lamp1DepositorAvailable SinceAug. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
CaTCH BC1
Plasmid#154195PurposeLentiviral CaTCH barcoding plasmid harboring a single barcode cassette (BC1)DepositorInsertCaTCH BC1
UseLentiviral; Catch barcode labelingExpressionMammalianAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-EF1α1.1-FLEX-rc [Jaws-KGC-GFP-ER2]
Plasmid#108274PurposeAAV-mediated expression of Jaws-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertJaws-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationK200R W214FPromoterEF1α promoter (1.1kb short version)Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast POLA1
Plasmid#160807PurposeExpress POLA1DepositorAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET264-pUC 24xMS2V6 Loxp KANr Loxp
Plasmid#104393PurposeYeast endogenous mRNA taggingDepositorInsert24xMS2V6
ExpressionBacterialMutationAll Loops are U-variants, interspaced by 50 nucle…Available SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Cry2olig
Plasmid#208780PurposeInducibly expresses light activatable Cry2 domainDepositorInsertCry2 mCherry
UseLentiviralExpressionMammalianAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 MYC
Plasmid#176045PurposeExpresses Myc in Mammalian cellsDepositorInsertMyc
ExpressionMammalianPromoterCMVAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP13A3 WT
Plasmid#195849PurposeExpresses wild-type Homo sapiens ATP13A3DepositorInsertATPase 13A3 (ATP13A3 Human)
UseLentiviralMutationD498N, L956P, M850I, V855M, R858H, L675VPromoterCMVAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
hGli2 flag3x
Plasmid#84920Purposemammalian expression of Gli2DepositorAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -