173,172 results
-
Viral Prep#225708-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-EF1a-Dio-ASAP5-Kv2.1-WPRE (#225708). In addition to the viral particles, you will also receive purified pAAV-EF1a-Dio-ASAP5-Kv2.1-WPRE plasmid DNA. EF1a-driven, Cre-dependent soma-targeted expression of genetically encoded voltage indicator ASAP5. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1αAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pTRIP-CMV-mCherry-53BP1
Plasmid#127658PurposeOver-express mCherry-53BP1 fragment to monitor 53BP1 foci.DepositorInsert53BP1 (TP53BP1 Human)
UseLentiviralTagsmCherryMutationNucleotides 3658-5133 of TP53BP1 (NM_005657.2) fu…Available SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_Puro_hPGK1_EGFP_Donor
Plasmid#178088PurposeHDR donor plasmid to introduce the EGFP cassette to AAVS1 using AAVS1 T2 sgRNA.DepositorInsertEGFP
UseCRISPRExpressionMammalianPromoterHuman PGK1Available SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-SARS2-Spike
Plasmid#145032PurposeExpress SARS-CoV-2 spike protein with C9 tag at C-terminal in mammalian cellsDepositorAvailable SinceApril 15, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3 Flag TSC2
Plasmid#14129DepositorAvailable SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCCL-CellCycle
Plasmid#132429PurposeExpressing Fucci cell cycle indicator in mammalian cellsDepositorInserthCdt, hGeminin
UseLentiviralExpressionMammalianAvailable SinceOct. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CMV.PI.EGFP.WPRE.bGH (AAV9)
Viral Prep#105530-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.CMV.PI.EGFP.WPRE.bGH (#105530). In addition to the viral particles, you will also receive purified pAAV.CMV.PI.EGFP.WPRE.bGH plasmid DNA. CMV-driven EGFP control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCMVTagsEGFPAvailable SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SpRY-ABE8e
Plasmid#185671PurposeExpresses SpRY-ABE8e in mammalian cellsDepositorInsertecTadA(8e)-nSpRY
UseCRISPRExpressionMammalianMutationSpRY D10AAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
LXRE_Luc
Plasmid#177622Purposesynthetic 3X LXRE promoter linked to luciferase in the pTAL vectorDepositorInsert3X LXRE
UseLuciferaseExpressionMammalianAvailable SinceApril 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSUB11
Plasmid#169699PurposeTemplate plasmid for generating C-terminal 3xFLAG epitope tag fusions to bacterial genes by "Lambda red" recombineering.DepositorInsert3xFLAG tag adjacent to FRT-flanked aph (KanR) gene
Tags3xFLAG tagExpressionBacterialAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
Flag-M4-AR
Plasmid#171240PurposeMammalian expression of 3xFlag-tagged human androgen receptor (hAR)DepositorAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-NE2h-IRES-mCherry-CAAX
Plasmid#208691PurposeExpresses the genetically-encoded fluorescent norepinephrine (NE) sensor GRAB_NE2h and a membrane-localized mcherry in mammalian cellsDepositorInsertGPCR activation based norepinephrine (NE) sensor GRAB_NE2h
ExpressionMammalianPromoterCMVAvailable SinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-dLight1.3b (AAV9)
Viral Prep#125560-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-CAG-dLight1.3b (#125560). In addition to the viral particles, you will also receive purified pAAV-CAG-dLight1.3b plasmid DNA. CAG-driven expression of dLight1.3b dopamine sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
V5-LOV-Turbo-NES
Plasmid#199545Purposeexpresses LOV-Turbo in the mammalian cytosol, lentiviral vectorDepositorInsertLOV-Turbo
UseLentiviralTagsNES and V5ExpressionMammalianPromoterTRE3GAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV_R-PTEN
Plasmid#227433PurposeExpresses the R-PTEN sensor under a CMV promoterDepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRC0940 (circRNA entry vector)
Plasmid#189967PurposeCloning vector for generating template plasmids to transcribe circRNA, with mNeonGreen dropout following BsaI digestionDepositorInsertmNeonGreen
ExpressionMammalianPromoterT7Available SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-EGFP-KASH
Plasmid#154373PurposeVector for Cre-dependent expression of EGFP tagged KASH protein domainDepositorInsertEGFP-KASH
UseAAV and Cre/LoxExpressionMammalianAvailable SinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
attP-puro donor
Plasmid#182139PurposeattP-puro DNA donor for twinPE and Bxb1 mediated gene-size insertionDepositorInsertattP-EGFP-EF1α-PuroR-T2A-TagBFP
ExpressionMammalianAvailable SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA_MET_D14_3Flag
Plasmid#182495PurposeContains cDNA of the MET gene without the exon 14DepositorAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSR657
Plasmid#65214PurposeBaculovirus-mediated rAAV production: Expresses bicistronic AAV-2 rep gene and polycistronic AAV-2 cap gene in Sf9 insect cellsDepositorInsertsmodified AAV-2 rep78
modified AAV-2 cap
UseAAVExpressionInsectPromoterp10 and polyhedrinAvailable SinceJune 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCW57-RFP-P2A-MCS
Plasmid#78933PurposeAll-in-one doxycycline inducible lentiviral vector for expression of one gene in combination with turbo RFP using the P2A self-cleaving peptide.DepositorTypeEmpty backboneUseLentiviral; Doxycycline inducible; p2a self cleav…ExpressionMammalianPromoterTight TRE promoterAvailable SinceJune 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-Soma-jGCaMP8m (AAV1)
Viral Prep#169257-AAV1PurposeReady-to-use AAV1 particles produced from AAV-hSyn-Soma-jGCaMP8m (#169257). In addition to the viral particles, you will also receive purified AAV-hSyn-Soma-jGCaMP8m plasmid DNA. Syn-driven expression of soma-targeted calcium sensor jGCaMP8m. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceJuly 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-DIO-BACE-HA (AAV8)
Viral Prep#232353-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-DIO-BACE-HA (#232353). In addition to the viral particles, you will also receive purified pAAV-DIO-BACE-HA plasmid DNA. Syn-driven, Beta-Secretase expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
LARRYv2-EGFP library 1
Pooled Library#233215PurposeBarcoding pooled libraryDepositorSpeciesSyntheticUseLentiviralAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-Volton2-ST-WPRE (AAV1)
Viral Prep#172907-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-FLEX-Volton2-ST-WPRE (#172907). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-Volton2-ST-WPRE plasmid DNA. Cre-dependent, Syn-driven expression of the voltage sensor Voltron2-ST containing a soma localization targeting sequence. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJuly 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCC001
Plasmid#124451PurposeMulti-species CRISPR/Cas9 coexpression system, optimized for Golden Gate cloning of gRNA targetsDepositorInsertHH-BsaI
ExpressionYeastMutationgRNA expression cassette from pUDP002 modified to…PromoterTDH3 promoter from S.cerevisiae (already present …Available SinceSept. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBTR(hCc)
Plasmid#61026PurposeExpresses horse holocytochrome c in E. coliDepositorAvailable SinceNov. 17, 2015AvailabilityAcademic Institutions and Nonprofits only