We narrowed to 895 results for: gcat
-
Plasmid#101152PurposegRNA with two MCP binding sitesDepositorAvailable SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only
-
CAG-EGFP-Otx2shRNA1
Plasmid#73981PurposeOtx2 shRNA1 (mir155 backbone) was inserted into the 3'UTR of EGFP.DepositorInsertshRNA that targets the mouse Otx2 gene
ExpressionMammalianPromoterCAGAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#1
Plasmid#107726PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV CMV-DIO-(mCherry-U6)-shRNA(anti-Crh)
Plasmid#214732PurposeExpresses shRNA against CRH, marked with mCherry, in infected and cre positive cellsDepositorInsertanti-Crh shRNA / mCherry
UseAAVAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
YN2_1_IL50_HOlocus
Plasmid#194426PurposeExpresses Cas9 and sgRNA cassettes for targeting the HO locus in yeast Saccharomyces cerevisiaeDepositorInsertCas9
ExpressionYeastMutationNAAvailable SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shStk16-1
Plasmid#180391PurposeProducing AAV that encodes mouse Stk16 shRNA-1 with miR-E backboneDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15415-BEAR-GFP-target-mCherry
Plasmid#162995Purposeplasmid expressing an sgRNA targeting the BEAR-GFP plasmid along with an mCherry markerDepositorInsertsgRNA targeting the BEAR-GFP plasmid
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-pX330-Cas9-mCherry
Plasmid#159742PurposeExpresses Cas9-2A-mCherry and a sgRNA excising EGFP flanked by a splice acceptor and a splice donor from the Intron-Tagging-EGFP-Donor plasmid.DepositorInsertdonor plasmid targeting sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRIN-E-shREN
Plasmid#105585PurposeDox-inducible mirE shREN(control shRNA)/dsRED expression with Venus marker and Neo resistanceDepositorInsertcontrol shRNA targeting luciferase
UseRNAi and RetroviralExpressionMammalianPromoterTREAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Tsc2-g2)-PGKpuroBFP-W
Plasmid#105040PurposeLentiviral gRNA plasmid targeting mouse Tsc2 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA1 gRNA (BRDN0001145974)
Plasmid#75497Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_4
Plasmid#155062PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
SGK1 gRNA (BRDN0001146486)
Plasmid#77459Purpose3rd generation lentiviral gRNA plasmid targeting human SGK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SL2-sgTelo-MTSa/BFP/pdCas9-C1
Plasmid#162760PurposeExpressing dCas9 and sgRNA containg MTSa targeting telomeresDepositorInsertdCas9 and sgRNA(SL2-sgTelo-MTSa)
ExpressionMammalianMutationdCas9(nuclease deactivated Cas9)PromoterU6/CMVAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
B270 + SMARCAL1 sgSTOP
Plasmid#100717PurposeB270 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) in combination with ATP1A1 sgSTOPDepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI) and ATP1A1 (SMARCAL1 Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDP010
Plasmid#101166PurposeE. coli/S. cerevisiae amdS shuttle vector expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaActin binding domain
Plasmid#187276PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Actin binding domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaActin binding domainPromoterU6, CMVAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA3 gRNA (BRDN0001148452)
Plasmid#75943Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CCL2 gRNA (BRDN0001145563)
Plasmid#77866Purpose3rd generation lentiviral gRNA plasmid targeting human CCL2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330.LoxP
Plasmid#66586PurposesgRNA for LSLDepositorInsertLoxP sgRNA
ExpressionMammalianAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
LHZ1494
Plasmid#222104PurposeTriple sgRNAs expression plasmid in Kluyveromyces marxianus.DepositorInsertsg1RNA, sg4RNA, sg7RNA
UseCRISPRExpressionYeastAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-RNF103-CHMP3
Plasmid#140584PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA RNF103-CHMP3
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shControl
Plasmid#180386PurposeProducing AAV that encodes negative control shRNA with miR-E backboneDepositorInsertshControl
UseAAV and RNAiPromoterCBAAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIAL1
Plasmid#106096PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIAL1DepositorInsertgRNA TIAL1
UseCRISPRAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4-miR30-TRIM5
Plasmid#132932PurposeLentivector for TRIM5 knockdown and puromycin resistanceDepositorInsertTRIM5 shRNA
UseLentiviral and RNAiPromoterSFFVAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pALPS puro miR30-IRF1
Plasmid#117156PurposeTarget site TTGCTCTTAGCATCTCGGCTGDepositorInsertshRNA targeting miR30
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSSBIO32_dCas9_RPA1786
Plasmid#240489PurposeCRISPRi-mediated Knockdown of RPA1786DepositorInsertCas9 (cas9 Streptococcus pyogenes)
UseCRISPRExpressionBacterialMutationD10A, H840APromoterPlacAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
VPS35 shRNA2
Plasmid#163859PurposeshRNA targeting the coding sequences of VPS35DepositorInsertVPS35 retromer complex component (VPS35 Human)
ExpressionMammalianAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgWRN-EIJ
Plasmid#125774Purposeconstitutive expression of a guide RNA targeting an exon-intron junction of human WRNDepositorInsertsgWRN-EIJ (WRN Human)
UseCRISPRAvailable SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_NEMF
Plasmid#127126DepositorInsertgRNA NEMF (NEMF Human)
UseCRISPRAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 shCAV1-NLS-mCherry
Plasmid#187257PurposeLentiviral expression of shRNA targeting Caveolin1 and NLS-mCherryDepositorAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPU-Empty-miR30-TRIM5
Plasmid#132936PurposeAll-in-one control rescue-TRIM5 shRNA knockdown vectorDepositorInsertcontrol shRNA
UseLentiviral and RNAiTagsHAExpressionMammalianPromoterSFFVAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDL639
Plasmid#231163PurposeT-DNA encoding TRV2 with mobile gRNAs targeting SlHAIRPLUS and SlAN2DepositorInsertmobile gRNAs targeting SlHAIRPLUS and SlAN2
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_SDHA
Plasmid#177980Purposelentiviral vector expressing Cas9 and a sgRNA targeting SDHADepositorInsertsgRNA targeting SDHA (SDHA Human)
UseLentiviralExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
CAG-mCherry-Otx2shRNA1
Plasmid#73979PurposeOtx2 shRNA1 (mir155 backbone) was inserted into the 3'UTR of mCherry.DepositorInsertshRNA that targets the mouse Otx2 gene
ExpressionMammalianPromoterCAGAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-Osp.gRNA-MS2in
Plasmid#229772PurposeContains the U6 promoter and an optimized gRNA backbone inserted with two copies of the MS2 stem loop.DepositorInsertgRNA cassette with two MS2 stem loops
UseCRISPRExpressionMammalianPromoterU6Available SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgLacZs
Plasmid#171185PurposeExpresses sgRNADepositorInserthU6-sgLacZ1-hU6-sgLacZ2
UseAAVTagsmCherryPromoterU6, hSynAvailable SinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE3-gRNA#2
Plasmid#107730PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDY2261 hACTB atgRNA Paired Guide 1
Plasmid#220991PurposehACTB atgRNADepositorInsertACTB atgRNA (ACTB Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDF0430 huDisCas7-11-S1006-GGGS-D1221-U6-pro-Gluc
Plasmid#186987PurposeAAV transgene plasmid for Cas7-11-S1006-GGGS-D1221, with U6 promoter-driven expression of Gluc crRNA guideDepositorInsertcas7-11-s1006-gggs-d122, Gluc crRNA guide
UseAAVMutations1006-gggs-d1221 deletionAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZLCv2-gMYOD1-3xFLAG-dCas9-HA-2xNLS
Plasmid#106355PurposeCRISPR/Cas9 engineered chromatin immunoprecipitation of MYOD1 locusDepositorInsertMYOD1 gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDL691
Plasmid#231166PurposeT-DNA encoding TRV2 with ipt and mobile gRNAs targeting SlUGT75C1 and SlHAIRLESSDepositorInsertipt and mobile gRNAs targeting SlUGT75C1 and SlHAIRLESS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRIN-shMYB.2652
Plasmid#105575PurposeDox-inducible mir30 MYB shRNA/dsRED expression with Venus marker and neo resistanceDepositorInsertMYB shRNA #2652
UseRNAi and RetroviralExpressionMammalianPromoterTREAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
PRKAA2 gRNA (BRDN0001148583)
Plasmid#76634Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAA2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
BII-Sh-FUCCI-Luc
Plasmid#133364PurposePiggybac vector for shRNA-mediated knockdown, co-expressed with FUCCI cell cycle reporterDepositorInsertClover-Geminin-IRES-mKO2-Cdt1
TagsHA-tagged Clover-GemininExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
LRPPRC gRNA (BRDN0001145987)
Plasmid#77773Purpose3rd generation lentiviral gRNA plasmid targeting human LRPPRCDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DCLK1 gRNA (BRDN0001147487)
Plasmid#76747Purpose3rd generation lentiviral gRNA plasmid targeting human DCLK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SL2-sgTelo-MTSa/EGFP/pdCas9-C1
Plasmid#162759PurposeExpressing dCas9 and sgRNA containg MTSa targeting telomeresDepositorInsertdCas9 and sgRNA(SL2-sgTelo-MTSa)
ExpressionMammalianMutationdCas9(nuclease deactivated Cas9)PromoterU6/CMVAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
DKC1 F2.3 gRNA
Plasmid#90653Purpose3rd generation lentiviral gRNA plasmid targeting human DKC1DepositorInsertDKC1 (Guide Designation F2.3)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only