We narrowed to 16,688 results for: GRN
-
Plasmid#198735PurposeAAV genome encoding C-terminal PE2max and U6 expression cassettesDepositorInsertNpuC-CtermPE2max∆RNaseH
UseAAVPromoterCbhAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR(RfxCas13d)-CAG-hfCas13d-pa
Plasmid#233036PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d from a CAG promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSECC
Plasmid#60820Purpose3rd generation vector. Expresses a sgRNA of interest, Cas9 and CreDepositorInsertsCas9
Cre
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingTagsFlagExpressionMammalianMutationBsmBI site eliminated by C->A; E308GPromoterEFS and EFS (after Cas9-2A)Available SinceNov. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCryptDel4.8
Plasmid#141293PurposePlasmid for curing pMUT2 in one step based on pFREE. Contains RelB antitoxin, as well as gRNA targetting pMUT2 plasmid as well as pCryptDel4.8 itself.DepositorInsertsRelB
gRNA targetting pMUT2
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterNative promoter from pMUT2 relB/relE operon and P…Available SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgSlc17a6
Plasmid#124847PurposeMutagenesis of Slc17a6 with SauCas9DepositorInsertSlc17a6 gRNA (Slc17a6 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-ABE N-terminal
Plasmid#137177PurposeAAV genome: expresses the N-terminal of v5 AAV-ABE from the Cbh promoterDepositorInsertv5 AAV-ABE N-terminal
UseAAVMutationCas9 D10APromoterCbhAvailable SinceJan. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV_NLS-dSaCas9-NLS-VPR
Plasmid#68495PurposeAAV vector containing nuclease null SaCas9 fused to VPRDepositorInsertdSaCas9
UseAAVTagsVPRExpressionMammalianPromoterCMVAvailable SinceSept. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
cBEST2
Plasmid#234658PurposeExpresses cytosine base editor - spCas9n (D10A) fused to APOBEC1 and UGI, Include Golden Gate compatible cassette for sgRNA insertionDepositorInsertsspCas9 cytosine base editor
Golden Gate compatible sgRNA insertion cassette
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterkasO*17tss and kasOp*Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.tRFP
Plasmid#57826PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses tagRFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-tRFP
UseCRISPR and LentiviralTagsFLAGAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-EGFP
Plasmid#188900PurposeHuman lentiviral vector for expression of EGFP from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertEGFP
UseLentiviralPromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
P789_pY026_EnAsCpf1_CLYBL_T1_catRNA
Plasmid#202760PurposeEncodes for CRISPR-Cas12a (EnAsCpf1) with gRNA for targeting the CLYBL safe harbor siteDepositorInserthuAsCpf1
ExpressionMammalianPromoterCMVAvailable SinceFeb. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ14901
Plasmid#239276PurposeExpresses gG1 for pertubing endogenous human GAPDH mRNA via CRISPR-TODepositorAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLQ14902
Plasmid#239277PurposeExpresses gG2 for pertubing endogenous human GAPDH mRNA via CRISPR-TODepositorAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDicAID_nCas9-PmCDA_NptII_Della
Plasmid#91694PurposeDicot Target-AID vector expressing dicot-optimized nCas9-PmCDA1 with sgRNA targeting SlDellaDepositorInsertSpCas9
TagsPmCDA1ExpressionPlantMutationD10A for nickase Cas9PromoterPcUbiAvailable SinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
bu6-sgCebpa_v1-mU6-sgCebpb_v1-hU6-sgCebpd_v1
Plasmid#177257PurposeExpresses Cebpa_v1 (bU6), Cebpb_v1 (mU6), Cebpd_v1 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpa_v1/sgCebpb_v1/sgCebpd_v1
UseLentiviralPromoterbU6/mU6/hU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTCas9_scr
Plasmid#207566PurposeThermoCas9-mediated cleavage of genomic DNA in E. coliDepositorInsertPlac/tet_ThermoCas9_PlacI_lacI_PJ23119_sgRNA(scrambled non-targeting spacer)
ExpressionBacterialMutationWild-typeAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHSN401
Plasmid#50588PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationmaize codon optimizedPromoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPapi
Plasmid#96921Purposeexpression of S aureus SaCas9 (SauCas9) and two pol III promoters for an Sa gRNA and an Sp gRNA. Intended to be used in SpCas9-expressing cell lines for dual Cas9 "Big Papi" screens. aka pXPR207.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only